Incidental Mutation 'R4711:Ring1'
ID 353285
Institutional Source Beutler Lab
Gene Symbol Ring1
Ensembl Gene ENSMUSG00000024325
Gene Name ring finger protein 1
Synonyms Ring1A
Accession Numbers
Essential gene? Possibly essential (E-score: 0.723) question?
Stock # R4711 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34239766-34243654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34241333 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 261 (E261G)
Ref Sequence ENSEMBL: ENSMUSP00000025183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025183] [ENSMUST00000045467] [ENSMUST00000114303]
AlphaFold O35730
Predicted Effect possibly damaging
Transcript: ENSMUST00000025183
AA Change: E261G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025183
Gene: ENSMUSG00000024325
AA Change: E261G

DomainStartEndE-ValueType
RING 48 87 7.92e-8 SMART
low complexity region 171 229 N/A INTRINSIC
low complexity region 236 261 N/A INTRINSIC
Pfam:RAWUL 272 400 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045467
SMART Domains Protein: ENSMUSP00000038069
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 201 1.5e-16 PFAM
Pfam:adh_short 10 213 4.5e-52 PFAM
Pfam:adh_short_C2 16 258 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083621
Predicted Effect probably benign
Transcript: ENSMUST00000114303
SMART Domains Protein: ENSMUSP00000133546
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 202 5.5e-16 PFAM
Pfam:adh_short 22 193 2.7e-30 PFAM
Pfam:adh_short_C2 23 234 1.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174399
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the RING finger family, members of which encode proteins characterized by a RING domain, a zinc-binding motif related to the zinc finger domain. The gene product can bind DNA and can act as a transcriptional repressor. It is associated with the multimeric polycomb group protein complex. The gene product interacts with the polycomb group proteins BMI1, EDR1, and CBX4, and colocalizes with these proteins in large nuclear domains. It interacts with the CBX4 protein via its glycine-rich C-terminal domain. The gene maps to the HLA class II region, where it is contiguous with the RING finger genes FABGL and HKE4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both homozygous and heterozygous mutant mice show axial skeleton defects including anterior transformations of vertebrae and rib abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg14 G A 14: 47,783,298 (GRCm39) R346C probably damaging Het
Bin3 A G 14: 70,366,288 (GRCm39) probably null Het
Ccser1 A G 6: 61,288,910 (GRCm39) N358D possibly damaging Het
Col20a1 G C 2: 180,634,284 (GRCm39) G83A probably damaging Het
Copa T G 1: 171,947,555 (GRCm39) F1124V probably damaging Het
Cyp2c66 G A 19: 39,151,843 (GRCm39) R186H possibly damaging Het
Dmxl2 G A 9: 54,358,208 (GRCm39) T323M probably benign Het
Dner T C 1: 84,361,618 (GRCm39) I664V possibly damaging Het
Erp29 A G 5: 121,583,293 (GRCm39) I211T possibly damaging Het
Exd1 A G 2: 119,369,232 (GRCm39) S128P possibly damaging Het
Grik4 T A 9: 42,540,389 (GRCm39) N264Y probably damaging Het
Gsdma2 T A 11: 98,540,439 (GRCm39) S119R probably damaging Het
H2ac1 C T 13: 24,118,796 (GRCm39) P118S possibly damaging Het
Ift140 T A 17: 25,313,691 (GRCm39) probably null Het
Ino80c T C 18: 24,247,222 (GRCm39) N59S probably benign Het
Maob T C X: 16,582,662 (GRCm39) T400A probably benign Het
Mast4 A G 13: 103,470,627 (GRCm39) V25A probably benign Het
Mr1 T C 1: 155,012,336 (GRCm39) T193A probably benign Het
Muc5b C A 7: 141,399,770 (GRCm39) F414L unknown Het
Nat10 A T 2: 103,578,612 (GRCm39) C197* probably null Het
Nt5c1b A G 12: 10,420,093 (GRCm39) K11E probably damaging Het
Or5k8 A T 16: 58,645,069 (GRCm39) M1K probably null Het
Or8i2 T C 2: 86,852,370 (GRCm39) I173V probably damaging Het
Pak5 A G 2: 135,929,437 (GRCm39) I582T probably damaging Het
Pcdha12 A G 18: 37,153,976 (GRCm39) I232V probably benign Het
Pde8b T A 13: 95,166,958 (GRCm39) T664S probably benign Het
Pdik1l G C 4: 134,006,301 (GRCm39) R214G probably benign Het
Prss37 C T 6: 40,492,381 (GRCm39) V157M probably benign Het
Psma5-ps A G 10: 85,149,667 (GRCm39) noncoding transcript Het
Sf3a3 C A 4: 124,621,974 (GRCm39) D371E probably benign Het
Spag9 T A 11: 94,005,177 (GRCm39) probably null Het
Spred1 T A 2: 117,005,866 (GRCm39) S209R probably benign Het
Tas2r121 T C 6: 132,677,853 (GRCm39) T40A probably benign Het
Tbc1d5 T C 17: 51,242,537 (GRCm39) T187A probably damaging Het
Tenm2 C T 11: 36,191,039 (GRCm39) V311I probably damaging Het
Thoc2l T C 5: 104,667,527 (GRCm39) V683A probably damaging Het
Tnrc6a A G 7: 122,770,301 (GRCm39) D697G probably damaging Het
Trappc14 T C 5: 138,261,167 (GRCm39) probably benign Het
Ttn G A 2: 76,660,404 (GRCm39) A7439V possibly damaging Het
Wdr64 T C 1: 175,626,795 (GRCm39) I838T probably damaging Het
Wdr7 A G 18: 63,861,536 (GRCm39) T183A probably benign Het
Other mutations in Ring1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ring1 APN 17 34,241,983 (GRCm39) missense possibly damaging 0.89
IGL01734:Ring1 APN 17 34,242,294 (GRCm39) missense probably damaging 1.00
IGL02420:Ring1 APN 17 34,242,122 (GRCm39) missense possibly damaging 0.67
R4762:Ring1 UTSW 17 34,240,971 (GRCm39) unclassified probably benign
R4770:Ring1 UTSW 17 34,242,361 (GRCm39) missense probably damaging 1.00
R4779:Ring1 UTSW 17 34,241,263 (GRCm39) unclassified probably benign
R4935:Ring1 UTSW 17 34,242,016 (GRCm39) missense probably benign 0.04
R5561:Ring1 UTSW 17 34,240,432 (GRCm39) missense possibly damaging 0.85
R5772:Ring1 UTSW 17 34,241,282 (GRCm39) missense possibly damaging 0.96
R6235:Ring1 UTSW 17 34,242,280 (GRCm39) missense probably damaging 0.98
R7060:Ring1 UTSW 17 34,242,364 (GRCm39) missense probably damaging 1.00
R7115:Ring1 UTSW 17 34,242,420 (GRCm39) missense probably damaging 0.97
R7363:Ring1 UTSW 17 34,243,336 (GRCm39) missense possibly damaging 0.68
R7380:Ring1 UTSW 17 34,240,694 (GRCm39) missense probably damaging 0.98
R7556:Ring1 UTSW 17 34,240,688 (GRCm39) missense possibly damaging 0.52
R7703:Ring1 UTSW 17 34,242,109 (GRCm39) missense probably damaging 1.00
R9289:Ring1 UTSW 17 34,241,547 (GRCm39) missense possibly damaging 0.73
R9716:Ring1 UTSW 17 34,240,420 (GRCm39) missense possibly damaging 0.85
Z1177:Ring1 UTSW 17 34,240,752 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAAAAGTTCTGGCTGGG -3'
(R):5'- ATGTAAGCTCTGACTCCGCC -3'

Sequencing Primer
(F):5'- TGTATGCATGCTTGACAGACACC -3'
(R):5'- AGACTCTGCTCCAGGCC -3'
Posted On 2015-10-21