Incidental Mutation 'R9289:Ring1'
ID 704172
Institutional Source Beutler Lab
Gene Symbol Ring1
Ensembl Gene ENSMUSG00000024325
Gene Name ring finger protein 1
Synonyms Ring1A
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.705) question?
Stock # R9289 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34020792-34024680 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34022573 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 190 (S190P)
Ref Sequence ENSEMBL: ENSMUSP00000025183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025183] [ENSMUST00000045467] [ENSMUST00000114303]
AlphaFold O35730
Predicted Effect possibly damaging
Transcript: ENSMUST00000025183
AA Change: S190P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025183
Gene: ENSMUSG00000024325
AA Change: S190P

DomainStartEndE-ValueType
RING 48 87 7.92e-8 SMART
low complexity region 171 229 N/A INTRINSIC
low complexity region 236 261 N/A INTRINSIC
Pfam:RAWUL 272 400 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045467
SMART Domains Protein: ENSMUSP00000038069
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 201 1.5e-16 PFAM
Pfam:adh_short 10 213 4.5e-52 PFAM
Pfam:adh_short_C2 16 258 8.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114303
SMART Domains Protein: ENSMUSP00000133546
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 202 5.5e-16 PFAM
Pfam:adh_short 22 193 2.7e-30 PFAM
Pfam:adh_short_C2 23 234 1.4e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the RING finger family, members of which encode proteins characterized by a RING domain, a zinc-binding motif related to the zinc finger domain. The gene product can bind DNA and can act as a transcriptional repressor. It is associated with the multimeric polycomb group protein complex. The gene product interacts with the polycomb group proteins BMI1, EDR1, and CBX4, and colocalizes with these proteins in large nuclear domains. It interacts with the CBX4 protein via its glycine-rich C-terminal domain. The gene maps to the HLA class II region, where it is contiguous with the RING finger genes FABGL and HKE4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both homozygous and heterozygous mutant mice show axial skeleton defects including anterior transformations of vertebrae and rib abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,523 T306I probably benign Het
Aurkb T C 11: 69,050,349 I250T probably damaging Het
C1qtnf1 A G 11: 118,443,846 T51A probably benign Het
C1rb G T 6: 124,575,313 R330L possibly damaging Het
Cd8b1 G A 6: 71,329,793 probably null Het
Cep57l1 A T 10: 41,731,086 D160E probably damaging Het
Ces1f C T 8: 93,265,863 S320N probably benign Het
Cfap54 A G 10: 92,821,074 S3039P possibly damaging Het
Chia1 A T 3: 106,115,186 probably benign Het
Chka T G 19: 3,885,953 F220V possibly damaging Het
Cmtm2b A G 8: 104,322,348 probably benign Het
Dhx30 T C 9: 110,091,535 T304A possibly damaging Het
Dhx30 A T 9: 110,093,121 D164E probably benign Het
Dip2b A T 15: 100,173,271 K661I probably damaging Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dopey2 T A 16: 93,771,793 L1581H probably damaging Het
Fam219a C A 4: 41,521,942 G46V probably damaging Het
Fer1l6 G A 15: 58,618,917 V1028M probably damaging Het
Glb1 C A 9: 114,420,490 A129E probably damaging Het
Gm11492 T A 11: 87,568,966 C513* probably null Het
Heatr1 T C 13: 12,432,727 V1767A probably benign Het
Ift88 T A 14: 57,480,742 S591T probably benign Het
Itgb4 A G 11: 115,994,361 K1023R probably benign Het
Mfng C A 15: 78,759,257 S250I probably damaging Het
Mmp9 A G 2: 164,954,880 T723A probably benign Het
Mzf1 T A 7: 13,051,607 H299L probably benign Het
Naa40 T C 19: 7,234,120 K47E possibly damaging Het
Ncdn A C 4: 126,750,110 F306L possibly damaging Het
Notch3 A G 17: 32,158,280 C246R probably damaging Het
Npc1l1 A T 11: 6,218,355 Y945* probably null Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1384 C T 11: 49,513,808 P57S probably damaging Het
Olfr332 T A 11: 58,489,919 I279L probably benign Het
Olfr669 T C 7: 104,938,609 W28R probably damaging Het
Pcnx C A 12: 81,982,079 D1044E Het
Pgm2l1 T A 7: 100,270,422 I575K probably damaging Het
Plat T C 8: 22,782,084 I553T probably damaging Het
Prrc2c A G 1: 162,679,561 V2513A probably benign Het
Qser1 A T 2: 104,787,248 V983E possibly damaging Het
Rnf150 A G 8: 82,990,353 E163G probably benign Het
Scgb2b12 T C 7: 32,326,635 H44R probably benign Het
Shtn1 T C 19: 59,009,825 K379E probably damaging Het
Slc52a2 G T 15: 76,540,275 V238L probably benign Het
Smg1 T C 7: 118,145,416 H3171R possibly damaging Het
Tada3 A G 6: 113,370,303 V342A possibly damaging Het
Tbc1d20 T C 2: 152,311,342 V264A probably damaging Het
Tmco5 G A 2: 116,880,264 A22T probably benign Het
Tmem63b A G 17: 45,664,771 F549S probably benign Het
Trav16d-dv11 T C 14: 53,047,629 F54S probably benign Het
Trim7 A T 11: 48,845,454 K5* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Zfp78 T C 7: 6,378,368 I139T probably benign Het
Zfp839 T A 12: 110,868,444 V711D probably benign Het
Other mutations in Ring1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ring1 APN 17 34023009 missense possibly damaging 0.89
IGL01734:Ring1 APN 17 34023320 missense probably damaging 1.00
IGL02420:Ring1 APN 17 34023148 missense possibly damaging 0.67
R4711:Ring1 UTSW 17 34022359 missense possibly damaging 0.72
R4762:Ring1 UTSW 17 34021997 unclassified probably benign
R4770:Ring1 UTSW 17 34023387 missense probably damaging 1.00
R4779:Ring1 UTSW 17 34022289 unclassified probably benign
R4935:Ring1 UTSW 17 34023042 missense probably benign 0.04
R5561:Ring1 UTSW 17 34021458 missense possibly damaging 0.85
R5772:Ring1 UTSW 17 34022308 missense possibly damaging 0.96
R6235:Ring1 UTSW 17 34023306 missense probably damaging 0.98
R7060:Ring1 UTSW 17 34023390 missense probably damaging 1.00
R7115:Ring1 UTSW 17 34023446 missense probably damaging 0.97
R7363:Ring1 UTSW 17 34024362 missense possibly damaging 0.68
R7380:Ring1 UTSW 17 34021720 missense probably damaging 0.98
R7556:Ring1 UTSW 17 34021714 missense possibly damaging 0.52
R7703:Ring1 UTSW 17 34023135 missense probably damaging 1.00
Z1177:Ring1 UTSW 17 34021778 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTTCTCCACAAGCAGGG -3'
(R):5'- CTGAAGTTTAACACTAAGGGCTTG -3'

Sequencing Primer
(F):5'- AGCTCAATCTCTCCACCGGG -3'
(R):5'- ACTAAGGGCTTGAATCCTGC -3'
Posted On 2022-03-25