Incidental Mutation 'R4689:Gfra3'
ID354804
Institutional Source Beutler Lab
Gene Symbol Gfra3
Ensembl Gene ENSMUSG00000024366
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 3
SynonymsGFRalpha3, GFR alpha-3
MMRRC Submission 041940-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R4689 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location34689903-34720387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34690587 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 381 (P381S)
Ref Sequence ENSEMBL: ENSMUSP00000025224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025224]
Predicted Effect unknown
Transcript: ENSMUST00000025224
AA Change: P381S
SMART Domains Protein: ENSMUSP00000025224
Gene: ENSMUSG00000024366
AA Change: P381S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
GDNF 41 122 1.33e-15 SMART
GDNF 159 236 5.57e-18 SMART
GDNF 245 337 9.84e-28 SMART
low complexity region 380 393 N/A INTRINSIC
Meta Mutation Damage Score 0.2138 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the glial cell line-derived neurotrophic receptor (GDNFR) family of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein mediates binding of the ligand artemin to the ret receptor tyrosine kinase, and this interaction may regulate thermal pain and axon regeneration. Homozygous knockout mice for this gene exhibit impaired proliferation of cultured neuroblasts and impaired development of the superior cervical ganglion. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruption of this gene display ptosis and poor development of the sympathetic chain ganglia and associated nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C A 17: 46,324,070 V336L probably benign Het
Acbd4 T C 11: 103,105,368 L165P possibly damaging Het
Adam10 T C 9: 70,765,954 S456P possibly damaging Het
Adgre4 T C 17: 55,802,096 F368L probably damaging Het
Ahcyl1 G T 3: 107,665,518 Y528* probably null Het
Aldh3b3 G A 19: 3,964,516 V84M probably damaging Het
Cdca8 C T 4: 124,931,103 G78E probably damaging Het
Cry2 T C 2: 92,424,554 D152G probably benign Het
Cyp2c67 T C 19: 39,638,588 Y266C probably benign Het
Dkk4 T C 8: 22,625,320 F62S probably benign Het
Dnah12 G A 14: 26,706,839 V207I probably benign Het
Dthd1 T C 5: 62,842,912 C526R probably damaging Het
Dubr A T 16: 50,732,503 noncoding transcript Het
F5 T C 1: 164,151,973 probably benign Het
Flcn A C 11: 59,801,044 W260G possibly damaging Het
Fmnl1 G A 11: 103,193,736 probably null Het
Frem2 A T 3: 53,547,635 D2173E probably benign Het
Fstl4 C T 11: 53,068,650 Q173* probably null Het
Gm28308 C A 6: 52,213,311 probably benign Het
Gm8394 T A 10: 85,314,201 noncoding transcript Het
Gm8730 T A 8: 102,865,747 noncoding transcript Het
Gzmd T C 14: 56,131,226 probably null Het
Hexb A G 13: 97,181,092 Y366H probably damaging Het
Hydin A T 8: 110,595,414 H4566L probably benign Het
Ifi213 G A 1: 173,590,420 T142I possibly damaging Het
Kif13b T A 14: 64,773,064 C1271S probably damaging Het
Krtap9-5 G T 11: 99,949,460 C329F unknown Het
Larp1 G T 11: 58,041,613 G207W probably damaging Het
Lfng A G 5: 140,614,439 D368G probably damaging Het
Mbd5 G A 2: 49,258,279 V834I possibly damaging Het
Mterf1b T A 5: 4,197,263 Y301* probably null Het
Myh7b T C 2: 155,630,514 I1305T possibly damaging Het
Myo16 T C 8: 10,438,890 V687A probably damaging Het
Naip2 A T 13: 100,148,812 I1292N probably damaging Het
Nmral1 A G 16: 4,714,558 F130L probably damaging Het
Nos1 A G 5: 117,879,385 N271S probably benign Het
Nrap A G 19: 56,386,026 S23P probably damaging Het
Olfr106-ps A T 17: 37,394,771 N77I probably damaging Het
Olfr1509 T C 14: 52,451,214 I267T probably benign Het
Olfr169 A T 16: 19,566,513 Y123* probably null Het
Olfr800 T C 10: 129,660,316 V170A probably benign Het
Pkdcc C G 17: 83,215,861 C132W probably damaging Het
Plekhg6 G A 6: 125,373,181 L265F probably benign Het
Prkaa1 A G 15: 5,178,696 T473A probably benign Het
Prpf3 G A 3: 95,836,489 Q451* probably null Het
Ptprh T A 7: 4,597,997 D127V possibly damaging Het
Rab36 T C 10: 75,041,933 probably null Het
Rasa1 A T 13: 85,238,163 Y427* probably null Het
Rgs11 T C 17: 26,204,547 probably null Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Shank2 G A 7: 144,420,605 V1087I probably benign Het
Slc39a10 A C 1: 46,836,013 M43R probably benign Het
Slc40a1 T A 1: 45,912,313 Q228L probably benign Het
Slc45a1 A T 4: 150,638,539 L296Q probably benign Het
Stambpl1 A G 19: 34,236,291 T307A probably benign Het
Stt3a T C 9: 36,732,929 T705A possibly damaging Het
Tec G A 5: 72,823,637 probably benign Het
Trp63 A T 16: 25,865,262 T300S possibly damaging Het
Vmn1r235 A G 17: 21,262,361 H316R probably benign Het
Vmn2r1 A G 3: 64,104,653 H645R possibly damaging Het
Wdfy4 A G 14: 33,109,548 I907T possibly damaging Het
Zcchc10 A G 11: 53,327,324 T33A probably benign Het
Zfp318 T A 17: 46,399,634 V761D probably damaging Het
Zfp358 T C 8: 3,496,146 probably null Het
Zfp661 G A 2: 127,577,548 P224L probably damaging Het
Zfp937 T C 2: 150,236,786 M33T probably damaging Het
Zfp955a T C 17: 33,242,066 H364R probably damaging Het
Other mutations in Gfra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Gfra3 APN 18 34691548 critical splice donor site probably null
IGL01778:Gfra3 APN 18 34691591 missense possibly damaging 0.65
IGL02051:Gfra3 APN 18 34695841 missense possibly damaging 0.95
R0107:Gfra3 UTSW 18 34711306 missense probably benign 0.04
R0573:Gfra3 UTSW 18 34691615 missense probably benign
R1029:Gfra3 UTSW 18 34690839 missense probably benign 0.01
R1870:Gfra3 UTSW 18 34711320 missense probably damaging 0.97
R2512:Gfra3 UTSW 18 34704511 missense probably benign 0.04
R4801:Gfra3 UTSW 18 34720192 missense probably damaging 0.98
R4802:Gfra3 UTSW 18 34720192 missense probably damaging 0.98
R4884:Gfra3 UTSW 18 34711251 missense probably benign 0.00
R5824:Gfra3 UTSW 18 34711211 missense probably damaging 1.00
R6111:Gfra3 UTSW 18 34690874 missense probably damaging 1.00
R6192:Gfra3 UTSW 18 34704529 missense possibly damaging 0.87
R6228:Gfra3 UTSW 18 34695793 missense probably damaging 1.00
R6251:Gfra3 UTSW 18 34695811 frame shift probably null
R6759:Gfra3 UTSW 18 34695873 nonsense probably null
R6781:Gfra3 UTSW 18 34711322 missense possibly damaging 0.56
R6894:Gfra3 UTSW 18 34695657 missense probably damaging 1.00
R7021:Gfra3 UTSW 18 34690880 missense probably benign 0.00
R7232:Gfra3 UTSW 18 34711181 missense probably damaging 1.00
R7236:Gfra3 UTSW 18 34695831 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAACTAGCCGCTCAGGATC -3'
(R):5'- AGTGGCCGTGAATACCAGAG -3'

Sequencing Primer
(F):5'- TAAGACCTCTTCTGGAGCAGACG -3'
(R):5'- TGGCCGTGAATACCAGAGATCTC -3'
Posted On2015-10-21