Incidental Mutation 'R0107:Gfra3'
ID33351
Institutional Source Beutler Lab
Gene Symbol Gfra3
Ensembl Gene ENSMUSG00000024366
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 3
SynonymsGFRalpha3, GFR alpha-3
MMRRC Submission 038393-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R0107 (G1)
Quality Score225
Status Validated (trace)
Chromosome18
Chromosomal Location34689903-34720387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34711306 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 60 (H60Q)
Ref Sequence ENSEMBL: ENSMUSP00000025224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025224]
Predicted Effect probably benign
Transcript: ENSMUST00000025224
AA Change: H60Q

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025224
Gene: ENSMUSG00000024366
AA Change: H60Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
GDNF 41 122 1.33e-15 SMART
GDNF 159 236 5.57e-18 SMART
GDNF 245 337 9.84e-28 SMART
low complexity region 380 393 N/A INTRINSIC
Meta Mutation Damage Score 0.1111 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the glial cell line-derived neurotrophic receptor (GDNFR) family of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein mediates binding of the ligand artemin to the ret receptor tyrosine kinase, and this interaction may regulate thermal pain and axon regeneration. Homozygous knockout mice for this gene exhibit impaired proliferation of cultured neuroblasts and impaired development of the superior cervical ganglion. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruption of this gene display ptosis and poor development of the sympathetic chain ganglia and associated nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,080,834 V825A probably benign Het
Adamts7 T C 9: 90,180,720 I409T possibly damaging Het
Adck1 T C 12: 88,446,656 W253R possibly damaging Het
Afg3l2 A G 18: 67,431,766 F213L probably damaging Het
Ankle2 T C 5: 110,253,027 V743A probably benign Het
Ankrd34c C T 9: 89,729,484 R268H probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc7b T G 8: 129,178,197 probably benign Het
Cd320 A T 17: 33,848,085 M169L probably benign Het
Chn1 A G 2: 73,614,684 Y338H probably damaging Het
Chuk T A 19: 44,096,919 S263C probably damaging Het
Dennd4b C A 3: 90,272,736 P663T possibly damaging Het
Dnajc24 T G 2: 106,001,914 probably benign Het
Fam172a A G 13: 77,902,814 D145G probably damaging Het
Fbn2 A G 18: 58,056,203 V1617A probably benign Het
Fermt2 T C 14: 45,464,822 N502D probably damaging Het
Frrs1 A T 3: 116,896,716 I3F probably damaging Het
Fut1 C A 7: 45,618,846 Q20K possibly damaging Het
Gbf1 T C 19: 46,284,828 V1709A probably benign Het
Gm10750 T A 2: 149,016,053 M93L unknown Het
Gm5538 T A 3: 59,752,316 L397I possibly damaging Het
Hmcn1 T A 1: 150,587,015 I5124L probably benign Het
Hps3 A C 3: 20,030,796 L76R probably damaging Het
Ifrd1 T A 12: 40,214,081 Q105L probably damaging Het
Irs2 A T 8: 11,004,691 V1247E probably damaging Het
Itgal T C 7: 127,328,559 probably benign Het
Ivns1abp A T 1: 151,361,570 N495I probably damaging Het
Kank1 T A 19: 25,430,366 probably benign Het
Mroh8 T C 2: 157,225,468 Q657R probably benign Het
Mthfd1l T C 10: 4,041,838 Y597H probably benign Het
Myom1 G A 17: 71,077,365 V692I probably damaging Het
Olfr347 T G 2: 36,734,718 Y132* probably null Het
Olfr45 A T 7: 140,691,345 M147L probably benign Het
Olfr835 A G 9: 19,035,333 D70G probably damaging Het
Palmd A T 3: 116,924,076 H257Q probably damaging Het
Pcnx2 A T 8: 125,753,586 V1994D probably benign Het
Phkb G A 8: 86,016,931 G553S probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Ptprn A T 1: 75,255,712 L453M probably damaging Het
Ptprz1 T A 6: 23,000,570 D886E probably damaging Het
Rcn1 T A 2: 105,394,781 I110F possibly damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Slc6a19 A G 13: 73,684,057 Y467H possibly damaging Het
Slc9c1 T A 16: 45,575,420 D611E probably benign Het
Slitrk6 T C 14: 110,751,963 E104G possibly damaging Het
Spag17 A T 3: 100,050,787 K920N possibly damaging Het
St3gal5 A G 6: 72,142,149 S82G probably benign Het
Tlk1 T C 2: 70,713,989 *767W probably null Het
Tln2 A G 9: 67,370,706 V342A probably damaging Het
Tmem104 T A 11: 115,202,180 M132K probably damaging Het
Tmem184c A G 8: 77,597,073 S387P possibly damaging Het
Tmtc1 A G 6: 148,425,913 V34A possibly damaging Het
Trim46 A G 3: 89,236,333 F596S probably damaging Het
Unc79 T A 12: 103,134,525 D1870E possibly damaging Het
Utp20 T C 10: 88,778,391 T1234A probably benign Het
Vmn1r31 T A 6: 58,472,743 T46S probably benign Het
Vps13a A T 19: 16,691,824 L1341Q probably benign Het
Wdr72 A T 9: 74,210,433 D821V probably damaging Het
Zfhx4 T C 3: 5,398,982 L1400P probably damaging Het
Zfp217 T A 2: 170,114,874 K735* probably null Het
Zfp235 A G 7: 24,137,116 Q29R probably damaging Het
Zfp628 A G 7: 4,920,168 Y463C probably damaging Het
Zkscan4 A G 13: 21,484,581 T401A possibly damaging Het
Other mutations in Gfra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Gfra3 APN 18 34691548 critical splice donor site probably null
IGL01778:Gfra3 APN 18 34691591 missense possibly damaging 0.65
IGL02051:Gfra3 APN 18 34695841 missense possibly damaging 0.95
R0573:Gfra3 UTSW 18 34691615 missense probably benign
R1029:Gfra3 UTSW 18 34690839 missense probably benign 0.01
R1870:Gfra3 UTSW 18 34711320 missense probably damaging 0.97
R2512:Gfra3 UTSW 18 34704511 missense probably benign 0.04
R4689:Gfra3 UTSW 18 34690587 missense unknown
R4801:Gfra3 UTSW 18 34720192 missense probably damaging 0.98
R4802:Gfra3 UTSW 18 34720192 missense probably damaging 0.98
R4884:Gfra3 UTSW 18 34711251 missense probably benign 0.00
R5824:Gfra3 UTSW 18 34711211 missense probably damaging 1.00
R6111:Gfra3 UTSW 18 34690874 missense probably damaging 1.00
R6192:Gfra3 UTSW 18 34704529 missense possibly damaging 0.87
R6228:Gfra3 UTSW 18 34695793 missense probably damaging 1.00
R6251:Gfra3 UTSW 18 34695811 frame shift probably null
R6759:Gfra3 UTSW 18 34695873 nonsense probably null
R6781:Gfra3 UTSW 18 34711322 missense possibly damaging 0.56
R6894:Gfra3 UTSW 18 34695657 missense probably damaging 1.00
R7021:Gfra3 UTSW 18 34690880 missense probably benign 0.00
R7232:Gfra3 UTSW 18 34711181 missense probably damaging 1.00
R7236:Gfra3 UTSW 18 34695831 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACAGTGGTCTTACCAAGGCTTC -3'
(R):5'- CTGGACTGAGCAACTTCTTCCCATC -3'

Sequencing Primer
(F):5'- TTACCAAGGCTTCGGGCAG -3'
(R):5'- tgaagcaaccagtgccc -3'
Posted On2013-05-09