Mutagenetix > Incidental Mutations

Incidental Mutation 'R0107:Gfra3'

33351

Institutional Source

Beutler Lab

Gene Symbol

Gfra3

Ensembl Gene

ENSMUSG00000024366

Gene Name

glial cell line derived neurotrophic factor family receptor alpha 3

Synonyms

GFRalpha3, GFR alpha-3

MMRRC Submission

038393-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.187) question?

Stock #

R0107 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

34689903-34720387 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 34711306 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 60 (H60Q)

Ref Sequence

ENSEMBL: ENSMUSP00000025224 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025224]

Predicted Effect

probably benign
Transcript: ENSMUST00000025224
AA Change: H60Q

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000025224
Gene: ENSMUSG00000024366
AA Change: H60Q

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
GDNF	41	122	1.33e-15	SMART
GDNF	159	236	5.57e-18	SMART
GDNF	245	337	9.84e-28	SMART
low complexity region	380	393	N/A	INTRINSIC

Meta Mutation Damage Score

0.1111

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 90.6%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: This gene encodes a cell surface glycoprotein and member of the glial cell line-derived neurotrophic receptor (GDNFR) family of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein mediates binding of the ligand artemin to the ret receptor tyrosine kinase, and this interaction may regulate thermal pain and axon regeneration. Homozygous knockout mice for this gene exhibit impaired proliferation of cultured neuroblasts and impaired development of the superior cervical ganglion. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruption of this gene display ptosis and poor development of the sympathetic chain ganglia and associated nerves. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,080,834	V825A	probably benign	Het
Adamts7	T	C	9: 90,180,720	I409T	possibly damaging	Het
Adck1	T	C	12: 88,446,656	W253R	possibly damaging	Het
Afg3l2	A	G	18: 67,431,766	F213L	probably damaging	Het
Ankle2	T	C	5: 110,253,027	V743A	probably benign	Het
Ankrd34c	C	T	9: 89,729,484	R268H	probably benign	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Ccdc7b	T	G	8: 129,178,197		probably benign	Het
Cd320	A	T	17: 33,848,085	M169L	probably benign	Het
Chn1	A	G	2: 73,614,684	Y338H	probably damaging	Het
Chuk	T	A	19: 44,096,919	S263C	probably damaging	Het
Dennd4b	C	A	3: 90,272,736	P663T	possibly damaging	Het
Dnajc24	T	G	2: 106,001,914		probably benign	Het
Fam172a	A	G	13: 77,902,814	D145G	probably damaging	Het
Fbn2	A	G	18: 58,056,203	V1617A	probably benign	Het
Fermt2	T	C	14: 45,464,822	N502D	probably damaging	Het
Frrs1	A	T	3: 116,896,716	I3F	probably damaging	Het
Fut1	C	A	7: 45,618,846	Q20K	possibly damaging	Het
Gbf1	T	C	19: 46,284,828	V1709A	probably benign	Het
Gm10750	T	A	2: 149,016,053	M93L	unknown	Het
Gm5538	T	A	3: 59,752,316	L397I	possibly damaging	Het
Hmcn1	T	A	1: 150,587,015	I5124L	probably benign	Het
Hps3	A	C	3: 20,030,796	L76R	probably damaging	Het
Ifrd1	T	A	12: 40,214,081	Q105L	probably damaging	Het
Irs2	A	T	8: 11,004,691	V1247E	probably damaging	Het
Itgal	T	C	7: 127,328,559		probably benign	Het
Ivns1abp	A	T	1: 151,361,570	N495I	probably damaging	Het
Kank1	T	A	19: 25,430,366		probably benign	Het
Mroh8	T	C	2: 157,225,468	Q657R	probably benign	Het
Mthfd1l	T	C	10: 4,041,838	Y597H	probably benign	Het
Myom1	G	A	17: 71,077,365	V692I	probably damaging	Het
Olfr347	T	G	2: 36,734,718	Y132*	probably null	Het
Olfr45	A	T	7: 140,691,345	M147L	probably benign	Het
Olfr835	A	G	9: 19,035,333	D70G	probably damaging	Het
Palmd	A	T	3: 116,924,076	H257Q	probably damaging	Het
Pcnx2	A	T	8: 125,753,586	V1994D	probably benign	Het
Phkb	G	A	8: 86,016,931	G553S	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Ptprn	A	T	1: 75,255,712	L453M	probably damaging	Het
Ptprz1	T	A	6: 23,000,570	D886E	probably damaging	Het
Rcn1	T	A	2: 105,394,781	I110F	possibly damaging	Het
Scn1a	T	A	2: 66,324,633	T661S	probably benign	Het
Slc6a19	A	G	13: 73,684,057	Y467H	possibly damaging	Het
Slc9c1	T	A	16: 45,575,420	D611E	probably benign	Het
Slitrk6	T	C	14: 110,751,963	E104G	possibly damaging	Het
Spag17	A	T	3: 100,050,787	K920N	possibly damaging	Het
St3gal5	A	G	6: 72,142,149	S82G	probably benign	Het
Tlk1	T	C	2: 70,713,989	*767W	probably null	Het
Tln2	A	G	9: 67,370,706	V342A	probably damaging	Het
Tmem104	T	A	11: 115,202,180	M132K	probably damaging	Het
Tmem184c	A	G	8: 77,597,073	S387P	possibly damaging	Het
Tmtc1	A	G	6: 148,425,913	V34A	possibly damaging	Het
Trim46	A	G	3: 89,236,333	F596S	probably damaging	Het
Unc79	T	A	12: 103,134,525	D1870E	possibly damaging	Het
Utp20	T	C	10: 88,778,391	T1234A	probably benign	Het
Vmn1r31	T	A	6: 58,472,743	T46S	probably benign	Het
Vps13a	A	T	19: 16,691,824	L1341Q	probably benign	Het
Wdr72	A	T	9: 74,210,433	D821V	probably damaging	Het
Zfhx4	T	C	3: 5,398,982	L1400P	probably damaging	Het
Zfp217	T	A	2: 170,114,874	K735*	probably null	Het
Zfp235	A	G	7: 24,137,116	Q29R	probably damaging	Het
Zfp628	A	G	7: 4,920,168	Y463C	probably damaging	Het
Zkscan4	A	G	13: 21,484,581	T401A	possibly damaging	Het

Other mutations in Gfra3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Gfra3	APN	18	34691548	critical splice donor site	probably null
IGL01778:Gfra3	APN	18	34691591	missense	possibly damaging	0.65
IGL02051:Gfra3	APN	18	34695841	missense	possibly damaging	0.95
R0573:Gfra3	UTSW	18	34691615	missense	probably benign
R1029:Gfra3	UTSW	18	34690839	missense	probably benign	0.01
R1870:Gfra3	UTSW	18	34711320	missense	probably damaging	0.97
R2512:Gfra3	UTSW	18	34704511	missense	probably benign	0.04
R4689:Gfra3	UTSW	18	34690587	missense	unknown
R4801:Gfra3	UTSW	18	34720192	missense	probably damaging	0.98
R4802:Gfra3	UTSW	18	34720192	missense	probably damaging	0.98
R4884:Gfra3	UTSW	18	34711251	missense	probably benign	0.00
R5824:Gfra3	UTSW	18	34711211	missense	probably damaging	1.00
R6111:Gfra3	UTSW	18	34690874	missense	probably damaging	1.00
R6192:Gfra3	UTSW	18	34704529	missense	possibly damaging	0.87
R6228:Gfra3	UTSW	18	34695793	missense	probably damaging	1.00
R6251:Gfra3	UTSW	18	34695811	frame shift	probably null
R6759:Gfra3	UTSW	18	34695873	nonsense	probably null
R6781:Gfra3	UTSW	18	34711322	missense	possibly damaging	0.56
R6894:Gfra3	UTSW	18	34695657	missense	probably damaging	1.00
R7021:Gfra3	UTSW	18	34690880	missense	probably benign	0.00
R7232:Gfra3	UTSW	18	34711181	missense	probably damaging	1.00
R7236:Gfra3	UTSW	18	34695831	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGACAGTGGTCTTACCAAGGCTTC -3'
(R):5'- CTGGACTGAGCAACTTCTTCCCATC -3'

Sequencing Primer
(F):5'- TTACCAAGGCTTCGGGCAG -3'
(R):5'- tgaagcaaccagtgccc -3'

Posted On

2013-05-09