Incidental Mutation 'R4901:Calcrl'
ID376136
Institutional Source Beutler Lab
Gene Symbol Calcrl
Ensembl Gene ENSMUSG00000059588
Gene Namecalcitonin receptor-like
SynonymsCRLR
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4901 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84330626-84425411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84333513 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 445 (I445V)
Ref Sequence ENSEMBL: ENSMUSP00000097527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074262] [ENSMUST00000099944]
Predicted Effect probably benign
Transcript: ENSMUST00000074262
AA Change: I445V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073875
Gene: ENSMUSG00000059588
AA Change: I445V

DomainStartEndE-ValueType
HormR 60 135 1.4e-26 SMART
Pfam:7tm_2 137 379 5.7e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099944
AA Change: I445V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097527
Gene: ENSMUSG00000059588
AA Change: I445V

DomainStartEndE-ValueType
HormR 60 135 1.4e-26 SMART
Pfam:7tm_2 137 379 3.2e-80 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality between E13.5-E14.5, hydrops fetalis and cardiovascular defects such as thin vascular smooth muscle walls and small, disorganized hearts resulting from a decrease in cell proliferation and an increasein apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 C T 9: 44,277,657 probably null Het
Arg2 T C 12: 79,147,711 V103A probably damaging Het
Bicra T A 7: 15,987,601 T664S possibly damaging Het
Bptf A T 11: 107,110,860 Y475* probably null Het
Ccdc110 G A 8: 45,943,400 R776Q probably benign Het
Ccnc A G 4: 21,727,894 N4S probably damaging Het
Ccni G A 5: 93,183,144 R323W probably damaging Het
Celsr2 T A 3: 108,406,987 M1241L possibly damaging Het
Cpd T C 11: 76,790,881 I1145M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2j8 T A 4: 96,479,086 D265V probably benign Het
Dennd2a T C 6: 39,522,687 T315A probably benign Het
Dgkz T A 2: 91,936,731 Q905L probably benign Het
Dnah8 G A 17: 30,840,714 probably null Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Gm12166 A G 11: 46,051,829 S156P probably damaging Het
Gm136 G A 4: 34,746,580 Q144* probably null Het
Gm5415 T C 1: 32,546,620 S70G probably benign Het
Gon4l T C 3: 88,908,151 V2008A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Isyna1 A T 8: 70,596,596 H414L probably damaging Het
Kif20b A G 19: 34,934,436 Y233C probably benign Het
Klk1 A T 7: 44,228,715 I132F probably damaging Het
Klre1 A T 6: 129,584,225 H183L probably benign Het
Lrp1b T C 2: 40,821,645 T3188A probably damaging Het
Mapk12 A T 15: 89,134,638 L198* probably null Het
Mt4 A C 8: 94,138,284 T29P possibly damaging Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Nr1h4 T C 10: 89,478,797 Q269R possibly damaging Het
Olfr1198 C G 2: 88,746,887 probably null Het
Olfr558 A G 7: 102,710,198 H313R probably benign Het
Pde1b A G 15: 103,526,685 I421V probably null Het
Pde3b A T 7: 114,508,190 T519S probably damaging Het
Phf21a T A 2: 92,357,001 C178* probably null Het
Phtf2 A G 5: 20,805,724 S88P possibly damaging Het
Pik3c3 A G 18: 30,302,929 M394V possibly damaging Het
Plxnb1 C T 9: 109,104,959 P752S probably benign Het
Pp2d1 C A 17: 53,515,009 G343V probably benign Het
Ppp6r2 A G 15: 89,259,069 I140V possibly damaging Het
Ppp6r3 C A 19: 3,467,229 V75L probably damaging Het
Ptprq T A 10: 107,688,414 H486L probably benign Het
Rasgrf1 C T 9: 89,995,003 T807M probably benign Het
Rasgrp3 C A 17: 75,514,116 Y439* probably null Het
Rbm44 A G 1: 91,153,328 T413A probably benign Het
Rnf135 T C 11: 80,198,836 C333R probably damaging Het
Scfd2 A G 5: 74,519,565 V309A probably damaging Het
Serpina3m A T 12: 104,389,649 K192* probably null Het
Sh3tc2 A G 18: 61,990,435 I756V probably benign Het
Slc27a4 T C 2: 29,812,636 V516A probably damaging Het
Sult2a5 T A 7: 13,625,263 C55S probably benign Het
Tarsl2 C T 7: 65,691,294 T783M probably benign Het
Tet2 A T 3: 133,467,044 I1819N possibly damaging Het
Timeless T C 10: 128,250,762 F1057L probably damaging Het
Ttn T A 2: 76,798,074 I12835F probably damaging Het
Uhrf1 T A 17: 56,310,834 D185E probably benign Het
Vmn2r74 G T 7: 85,955,991 S483* probably null Het
Xpo1 A T 11: 23,281,327 I304F possibly damaging Het
Zc3h11a A G 1: 133,624,711 S553P probably benign Het
Zdhhc1 A G 8: 105,472,852 S402P probably benign Het
Zwilch T C 9: 64,162,746 Y101C probably damaging Het
Other mutations in Calcrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Calcrl APN 2 84370454 missense probably benign 0.05
IGL01395:Calcrl APN 2 84368575 missense probably benign 0.25
IGL01672:Calcrl APN 2 84345070 missense probably damaging 1.00
IGL01738:Calcrl APN 2 84370449 missense probably benign 0.00
IGL01773:Calcrl APN 2 84370443 missense probably benign
IGL02007:Calcrl APN 2 84375324 missense probably benign
IGL02254:Calcrl APN 2 84348208 missense probably damaging 1.00
IGL02887:Calcrl APN 2 84339242 missense probably benign 0.04
R0008:Calcrl UTSW 2 84373274 missense probably benign 0.04
R0008:Calcrl UTSW 2 84373274 missense probably benign 0.04
R0485:Calcrl UTSW 2 84370091 missense probably benign 0.01
R1579:Calcrl UTSW 2 84333537 missense probably benign 0.00
R1640:Calcrl UTSW 2 84333677 missense probably damaging 0.98
R1694:Calcrl UTSW 2 84339287 missense probably damaging 1.00
R1731:Calcrl UTSW 2 84345168 critical splice donor site probably null
R1779:Calcrl UTSW 2 84351285 missense probably damaging 1.00
R1992:Calcrl UTSW 2 84370511 missense probably damaging 0.98
R2262:Calcrl UTSW 2 84345173 missense probably damaging 1.00
R2763:Calcrl UTSW 2 84370503 missense probably damaging 0.99
R3903:Calcrl UTSW 2 84368642 splice site probably benign
R4838:Calcrl UTSW 2 84351205 missense probably damaging 0.99
R4997:Calcrl UTSW 2 84351248 nonsense probably null
R4998:Calcrl UTSW 2 84339314 missense probably damaging 1.00
R5791:Calcrl UTSW 2 84351265 missense probably damaging 1.00
R5887:Calcrl UTSW 2 84370497 missense probably damaging 1.00
R6046:Calcrl UTSW 2 84375314 missense probably benign 0.00
R6207:Calcrl UTSW 2 84333530 missense probably benign 0.00
R6959:Calcrl UTSW 2 84370084 missense possibly damaging 0.76
R6972:Calcrl UTSW 2 84368578 missense probably benign
R7522:Calcrl UTSW 2 84373364 missense probably benign
R7653:Calcrl UTSW 2 84345185 nonsense probably null
R7911:Calcrl UTSW 2 84351231 missense probably damaging 1.00
R8082:Calcrl UTSW 2 84370442 missense possibly damaging 0.56
R8110:Calcrl UTSW 2 84339339 missense probably damaging 1.00
R8152:Calcrl UTSW 2 84339249 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGACTTCCATCTCTGAGGGC -3'
(R):5'- GAGTATTTTCAGCTCAACTAATGGG -3'

Sequencing Primer
(F):5'- TTTTCTCCCCCATAGAGAGAGGG -3'
(R):5'- CAGCTCAACTAATGGGTTGTTTTTGC -3'
Posted On2016-03-17