Incidental Mutation 'R0282:Ces3b'
ID37622
Institutional Source Beutler Lab
Gene Symbol Ces3b
Ensembl Gene ENSMUSG00000062181
Gene Namecarboxylesterase 3B
SynonymsES31L, Gm4738
MMRRC Submission 038504-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0282 (G1)
Quality Score177
Status Validated
Chromosome8
Chromosomal Location105083753-105093929 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105083851 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 26 (V26D)
Ref Sequence ENSEMBL: ENSMUSP00000090909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074403] [ENSMUST00000093221] [ENSMUST00000173088]
Predicted Effect probably benign
Transcript: ENSMUST00000074403
AA Change: V26D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000074004
Gene: ENSMUSG00000062181
AA Change: V26D

DomainStartEndE-ValueType
Pfam:COesterase 13 436 1.8e-127 PFAM
Pfam:Abhydrolase_3 147 303 2.8e-13 PFAM
Pfam:COesterase 423 497 5.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093221
AA Change: V26D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000090909
Gene: ENSMUSG00000062181
AA Change: V26D

DomainStartEndE-ValueType
Pfam:COesterase 13 547 9.5e-163 PFAM
Pfam:Abhydrolase_3 147 304 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173088
SMART Domains Protein: ENSMUSP00000134204
Gene: ENSMUSG00000062181

DomainStartEndE-ValueType
Pfam:COesterase 1 114 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173838
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
1700123L14Rik T C 6: 96,164,816 T416A probably benign Het
Afap1l2 A G 19: 56,916,221 S549P possibly damaging Het
Alcam A T 16: 52,295,741 C157S probably damaging Het
Aldh1a1 T C 19: 20,629,049 probably benign Het
Ano8 G A 8: 71,480,614 probably benign Het
Atr T C 9: 95,862,798 V56A probably benign Het
Aurkc T A 7: 7,002,428 probably null Het
Bnip3 T C 7: 138,898,030 D76G probably damaging Het
Cbr1 A G 16: 93,610,134 E246G possibly damaging Het
Ccdc157 G T 11: 4,146,708 A449D probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crk G T 11: 75,703,369 G261C probably damaging Het
Ctbp1 A G 5: 33,250,856 probably null Het
Ctnna1 G A 18: 35,244,122 V572I possibly damaging Het
D430041D05Rik T C 2: 104,201,244 Y1669C probably damaging Het
Dnah8 T C 17: 30,736,156 F2053S probably damaging Het
Dner G A 1: 84,405,965 T566M probably damaging Het
Dner A G 1: 84,445,380 probably benign Het
Edrf1 T C 7: 133,644,022 V223A probably benign Het
Fam169a A G 13: 97,097,715 probably benign Het
Fbxl3 G A 14: 103,095,225 H106Y probably damaging Het
Fiz1 A G 7: 5,009,201 V106A probably benign Het
Gapvd1 T A 2: 34,688,960 R654* probably null Het
Gm7589 G A 9: 59,146,005 noncoding transcript Het
Ifi202b A T 1: 173,977,360 S9T probably benign Het
Ipmk G C 10: 71,372,831 S149T probably benign Het
Irgm2 A G 11: 58,219,519 E24G probably benign Het
Itga2b A C 11: 102,460,846 V551G probably damaging Het
Itgad C T 7: 128,189,978 probably benign Het
Kcnh8 T A 17: 52,725,851 F55L probably damaging Het
Kdr G A 5: 75,950,100 probably benign Het
Krt35 T C 11: 100,095,747 Y147C probably damaging Het
Lamc1 A G 1: 153,255,312 F298L probably benign Het
Lrrk2 T C 15: 91,778,414 probably benign Het
Matn1 T C 4: 130,945,927 S69P probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Msto1 A G 3: 88,911,577 V257A possibly damaging Het
Mybpc3 G C 2: 91,124,024 probably benign Het
Mycn A G 12: 12,937,313 V361A probably benign Het
Myo10 A G 15: 25,793,167 T1277A probably damaging Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Olfr1199 G A 2: 88,756,456 T73I probably damaging Het
Olfr1510 A G 14: 52,410,263 V203A possibly damaging Het
Olfr267 A G 4: 58,785,344 I126T probably damaging Het
Olfr504 T A 7: 108,565,477 Q106L probably damaging Het
Otog C T 7: 46,277,493 T1222I possibly damaging Het
P4ha1 C T 10: 59,337,148 T23M probably damaging Het
Pld1 A T 3: 28,078,273 I537F probably benign Het
Plekhn1 A G 4: 156,228,323 probably benign Het
Pxdn C A 12: 29,984,440 S8* probably null Het
Rnf135 A T 11: 80,193,958 I186F probably damaging Het
Rock2 T C 12: 16,977,886 probably benign Het
Rph3a C A 5: 120,963,910 G88* probably null Het
Sarm1 G A 11: 78,474,980 Q740* probably null Het
Setd1b C A 5: 123,161,017 probably benign Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Slc2a4 A T 11: 69,946,355 V85E probably damaging Het
Swi5 A G 2: 32,280,754 Y54H probably damaging Het
Sycp1 A G 3: 102,915,795 probably benign Het
Tarm1 T C 7: 3,497,490 Y87C probably damaging Het
Tmem67 G A 4: 12,087,930 T72M probably damaging Het
Tor1a A G 2: 30,967,725 Y44H possibly damaging Het
Ttll5 T C 12: 85,996,053 Y1128H probably benign Het
Usp40 G A 1: 87,980,958 probably benign Het
Vmn2r18 A T 5: 151,585,203 M152K probably benign Het
Xirp2 T A 2: 67,513,380 D1988E probably damaging Het
Zfp420 A G 7: 29,875,680 I442V probably benign Het
Zyx A G 6: 42,356,005 E363G probably damaging Het
Other mutations in Ces3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Ces3b APN 8 105091574 missense probably benign 0.00
IGL01324:Ces3b APN 8 105093252 missense probably damaging 0.99
IGL02418:Ces3b APN 8 105085647 missense probably damaging 1.00
IGL02612:Ces3b APN 8 105085269 missense possibly damaging 0.83
IGL03400:Ces3b APN 8 105092936 missense probably damaging 1.00
R0244:Ces3b UTSW 8 105092635 missense probably damaging 1.00
R0800:Ces3b UTSW 8 105085269 missense possibly damaging 0.83
R1833:Ces3b UTSW 8 105085639 missense probably damaging 0.98
R2130:Ces3b UTSW 8 105092975 critical splice donor site probably null
R3790:Ces3b UTSW 8 105086888 missense possibly damaging 0.50
R4827:Ces3b UTSW 8 105086895 missense probably benign 0.12
R5411:Ces3b UTSW 8 105088632 missense possibly damaging 0.94
R5790:Ces3b UTSW 8 105092638 missense probably damaging 1.00
R5798:Ces3b UTSW 8 105088440 missense probably damaging 1.00
R5929:Ces3b UTSW 8 105093165 missense probably damaging 1.00
R6437:Ces3b UTSW 8 105092606 missense probably damaging 1.00
R6470:Ces3b UTSW 8 105088653 missense possibly damaging 0.87
R6943:Ces3b UTSW 8 105093078 missense probably damaging 1.00
R7828:Ces3b UTSW 8 105086596 missense probably damaging 1.00
R7856:Ces3b UTSW 8 105093262 makesense probably null
R7939:Ces3b UTSW 8 105093262 makesense probably null
Z1177:Ces3b UTSW 8 105085083 missense not run
Predicted Primers PCR Primer
(F):5'- GCCAGGCAAGAGTAGAATCATCCAC -3'
(R):5'- GAAGGAGTCTCACCCAGTTTTCCAC -3'

Sequencing Primer
(F):5'- aggggtggtggtggtgg -3'
(R):5'- AAGTAAGCTTCCTTTGTGACGC -3'
Posted On2013-05-23