Incidental Mutation 'R7856:Ces3b'
ID607239
Institutional Source Beutler Lab
Gene Symbol Ces3b
Ensembl Gene ENSMUSG00000062181
Gene Namecarboxylesterase 3B
SynonymsES31L, Gm4738
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7856 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105083753-105093929 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 105093262 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 572 (*572W)
Ref Sequence ENSEMBL: ENSMUSP00000090909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074403] [ENSMUST00000093221] [ENSMUST00000173088]
Predicted Effect probably null
Transcript: ENSMUST00000074403
AA Change: *522W
SMART Domains Protein: ENSMUSP00000074004
Gene: ENSMUSG00000062181
AA Change: *522W

DomainStartEndE-ValueType
Pfam:COesterase 13 436 1.8e-127 PFAM
Pfam:Abhydrolase_3 147 303 2.8e-13 PFAM
Pfam:COesterase 423 497 5.8e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093221
AA Change: *572W
SMART Domains Protein: ENSMUSP00000090909
Gene: ENSMUSG00000062181
AA Change: *572W

DomainStartEndE-ValueType
Pfam:COesterase 13 547 9.5e-163 PFAM
Pfam:Abhydrolase_3 147 304 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173088
SMART Domains Protein: ENSMUSP00000134204
Gene: ENSMUSG00000062181

DomainStartEndE-ValueType
Pfam:COesterase 1 114 2e-11 PFAM
Meta Mutation Damage Score 0.8614 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h T C 17: 25,389,477 T819A probably damaging Het
Ccdc34 T A 2: 110,044,227 Y310* probably null Het
Ccdc63 A G 5: 122,129,943 W8R probably benign Het
Ces2g G A 8: 104,966,382 V351I not run Het
Dgka T C 10: 128,736,664 N40S probably benign Het
Dnajc13 C A 9: 104,167,485 R1835L possibly damaging Het
Dusp7 C A 9: 106,368,868 A24E unknown Het
Ep400 T A 5: 110,666,584 T2931S probably damaging Het
Gm4847 A T 1: 166,634,826 L365Q probably damaging Het
Gtse1 C T 15: 85,864,141 T249M probably benign Het
Hook3 T C 8: 26,035,221 D619G probably damaging Het
Itsn1 T A 16: 91,908,487 probably null Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mx1 A G 16: 97,455,535 I148T probably damaging Het
Olfr1032 T A 2: 86,008,296 N173K probably damaging Het
Olfr786 A G 10: 129,437,016 E68G probably damaging Het
Orc3 T C 4: 34,585,647 I416V probably benign Het
Plcxd3 A T 15: 4,517,099 Y195F probably damaging Het
Ppp1r3a A T 6: 14,718,026 I963N probably benign Het
Ppp1r7 A G 1: 93,350,346 D69G possibly damaging Het
Rars A G 11: 35,808,585 V627A probably benign Het
Sash1 A G 10: 8,729,708 S973P probably benign Het
Slc22a28 T C 19: 8,063,333 T518A probably damaging Het
Slc4a9 C T 18: 36,528,698 H92Y probably benign Het
Son A G 16: 91,659,258 D1631G probably damaging Het
Stat5a T C 11: 100,883,902 W746R unknown Het
Thsd4 A T 9: 60,002,861 L508Q probably damaging Het
Tlx1 C T 19: 45,155,988 Q292* probably null Het
Ttc34 T C 4: 154,861,286 V259A probably benign Het
Xrn2 T G 2: 147,068,473 probably null Het
Yif1b A G 7: 29,244,620 D137G possibly damaging Het
Zfp850 A G 7: 27,990,474 I103T probably benign Het
Zfp937 T C 2: 150,239,547 V499A probably benign Het
Other mutations in Ces3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Ces3b APN 8 105091574 missense probably benign 0.00
IGL01324:Ces3b APN 8 105093252 missense probably damaging 0.99
IGL02418:Ces3b APN 8 105085647 missense probably damaging 1.00
IGL02612:Ces3b APN 8 105085269 missense possibly damaging 0.83
IGL03400:Ces3b APN 8 105092936 missense probably damaging 1.00
R0244:Ces3b UTSW 8 105092635 missense probably damaging 1.00
R0282:Ces3b UTSW 8 105083851 missense probably benign 0.00
R0800:Ces3b UTSW 8 105085269 missense possibly damaging 0.83
R1833:Ces3b UTSW 8 105085639 missense probably damaging 0.98
R2130:Ces3b UTSW 8 105092975 critical splice donor site probably null
R3790:Ces3b UTSW 8 105086888 missense possibly damaging 0.50
R4827:Ces3b UTSW 8 105086895 missense probably benign 0.12
R5411:Ces3b UTSW 8 105088632 missense possibly damaging 0.94
R5790:Ces3b UTSW 8 105092638 missense probably damaging 1.00
R5798:Ces3b UTSW 8 105088440 missense probably damaging 1.00
R5929:Ces3b UTSW 8 105093165 missense probably damaging 1.00
R6437:Ces3b UTSW 8 105092606 missense probably damaging 1.00
R6470:Ces3b UTSW 8 105088653 missense possibly damaging 0.87
R6943:Ces3b UTSW 8 105093078 missense probably damaging 1.00
R7828:Ces3b UTSW 8 105086596 missense probably damaging 1.00
R7939:Ces3b UTSW 8 105093262 makesense probably null
R8162:Ces3b UTSW 8 105090753 missense possibly damaging 0.83
Z1177:Ces3b UTSW 8 105085083 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTTGGCCCCAATTAAACC -3'
(R):5'- AGGGTTCAAGTCACTTTAGGAAG -3'

Sequencing Primer
(F):5'- TTGGCCCCAATTAAACCAGTTAG -3'
(R):5'- TCAAGTCACTTTAGGAAGAAACAGC -3'
Posted On2019-12-20