Incidental Mutation 'R4948:C87499'
ID383563
Institutional Source Beutler Lab
Gene Symbol C87499
Ensembl Gene ENSMUSG00000038330
Gene Nameexpressed sequence C87499
Synonyms
MMRRC Submission 042545-MU
Accession Numbers

Ncbi RefSeq:NM_198663.3; MGI:2140706

Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R4948 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location88627320-88634411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88628948 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 162 (L162H)
Ref Sequence ENSEMBL: ENSMUSP00000138736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053304] [ENSMUST00000107142] [ENSMUST00000107143] [ENSMUST00000134155] [ENSMUST00000156062]
Predicted Effect probably damaging
Transcript: ENSMUST00000053304
AA Change: L249H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056691
Gene: ENSMUSG00000038330
AA Change: L249H

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 425 4e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107142
Predicted Effect probably benign
Transcript: ENSMUST00000107143
Predicted Effect probably damaging
Transcript: ENSMUST00000134155
AA Change: L78H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000156062
AA Change: L162H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6841 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 94% (103/109)
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 17,118,290 probably null Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Alas1 A T 9: 106,246,878 L27* probably null Het
Aldh1a7 A G 19: 20,727,010 V40A possibly damaging Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
B3gnt5 A C 16: 19,769,144 M38L probably benign Het
Brd8 A G 18: 34,614,532 V92A probably damaging Het
Btla A T 16: 45,242,728 E151D probably benign Het
Cd79b T A 11: 106,312,861 T67S probably benign Het
Cep192 A G 18: 67,816,804 R320G probably benign Het
Chad A C 11: 94,565,702 D202A probably damaging Het
Chil6 A G 3: 106,388,672 probably benign Het
Cpz T C 5: 35,517,404 E167G possibly damaging Het
Crisp2 T G 17: 40,765,268 H225P probably damaging Het
Cyp2c23 T C 19: 44,021,699 Y69C possibly damaging Het
Dcp1a T A 14: 30,479,767 L49H probably damaging Het
Dnah6 T A 6: 73,053,689 H3380L probably benign Het
Dnm2 A G 9: 21,504,533 D721G possibly damaging Het
Dnpep G T 1: 75,316,760 T15K probably benign Het
Dock3 A T 9: 106,991,155 D643E probably damaging Het
Ear6 C T 14: 51,854,116 T40I possibly damaging Het
Fancm A G 12: 65,090,974 D313G probably damaging Het
Fbxw16 T A 9: 109,438,347 E272V probably damaging Het
Frmd4b T A 6: 97,306,730 E393D probably benign Het
Fryl T A 5: 73,089,130 M1100L probably benign Het
Gjc1 T C 11: 102,800,421 H252R probably damaging Het
Gm10518 T C 1: 179,803,912 probably benign Het
Gna14 A G 19: 16,603,292 M165V probably benign Het
Hells C A 19: 38,935,522 Q72K probably damaging Het
Herc1 A G 9: 66,484,902 I4031V probably benign Het
Hspa2 C T 12: 76,405,987 A485V probably damaging Het
Ighv1-54 T A 12: 115,193,818 I70F probably benign Het
Il20rb A T 9: 100,461,539 probably benign Het
Krt1 C A 15: 101,845,941 V625L unknown Het
Lamc3 T C 2: 31,940,736 I1495T probably benign Het
Larp6 A G 9: 60,737,780 E401G possibly damaging Het
Ldha A T 7: 46,847,381 H19L probably benign Het
Lrba A G 3: 86,285,028 N83S probably damaging Het
Lrp4 G T 2: 91,485,886 R783L probably benign Het
Lrrk2 T G 15: 91,803,389 I2227S probably benign Het
Lvrn T C 18: 46,880,736 L495P probably damaging Het
Macf1 T C 4: 123,497,755 N1077S probably damaging Het
Mboat1 A G 13: 30,241,230 T425A probably damaging Het
Mcam A G 9: 44,136,566 E36G probably damaging Het
Meis1 T A 11: 19,016,308 T22S probably benign Het
Micu1 A G 10: 59,863,254 K451R possibly damaging Het
Mrvi1 A G 7: 110,888,029 V498A probably damaging Het
Nat8 A T 6: 85,830,523 D209E probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nmral1 G A 16: 4,716,410 R56* probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1002 T C 2: 85,647,572 I250V probably benign Het
Olfr1408 A G 1: 173,130,959 V86A probably benign Het
Olfr1451 A T 19: 12,999,831 T282S probably benign Het
Olfr192 G A 16: 59,098,977 T5I probably damaging Het
Palm3 A T 8: 84,027,079 R132* probably null Het
Pax2 A G 19: 44,816,040 Y272C probably damaging Het
Phc2 G A 4: 128,723,115 A394T probably benign Het
Phf2 C A 13: 48,807,722 G831C unknown Het
Pik3c2b G A 1: 133,099,715 probably null Het
Plin2 T A 4: 86,661,991 I178F probably benign Het
Prdm14 T A 1: 13,122,631 I295F probably damaging Het
Psmd5 C T 2: 34,870,783 R47H probably benign Het
Ptchd3 T A 11: 121,842,516 I744K probably damaging Het
Ptrh1 T A 2: 32,776,545 probably benign Het
Rab6a A G 7: 100,628,420 D49G probably damaging Het
Radil A T 5: 142,485,239 D1062E probably benign Het
Robo2 A G 16: 74,352,838 V34A possibly damaging Het
Sall3 G A 18: 80,971,411 P1029S probably benign Het
Sec14l3 A G 11: 4,068,101 D127G possibly damaging Het
Sel1l2 A G 2: 140,244,166 Y502H probably damaging Het
Serpina1f A G 12: 103,689,751 V406A probably damaging Het
Sf3b3 T C 8: 110,813,669 D1040G probably damaging Het
Sgcd A G 11: 46,979,435 I233T possibly damaging Het
Slc15a3 A G 19: 10,843,046 Q9R probably benign Het
Slc25a46 A G 18: 31,583,283 F389L probably damaging Het
Slc26a2 G T 18: 61,198,258 C700* probably null Het
Slc4a7 A G 14: 14,771,283 Y671C possibly damaging Het
Slc5a10 A T 11: 61,719,882 I22N probably damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slc6a12 A G 6: 121,355,322 D205G probably benign Het
Tas2r115 G A 6: 132,737,161 H276Y probably damaging Het
Tdpoz4 T A 3: 93,797,011 I205N probably damaging Het
Tfeb C T 17: 47,785,979 T33I probably benign Het
Tgm3 A G 2: 130,048,320 T668A probably benign Het
Tnpo3 A G 6: 29,582,260 V201A probably benign Het
Tpcn1 T A 5: 120,556,531 M158L probably benign Het
Trim47 A C 11: 116,106,092 L612R probably damaging Het
Trmt10c A T 16: 56,034,075 L399* probably null Het
Trpm2 A T 10: 77,917,792 S1293T probably benign Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Tubgcp5 A G 7: 55,806,123 I300V probably benign Het
Uty T A Y: 1,136,883 Q844L probably damaging Het
Vmn2r85 C T 10: 130,419,121 E565K probably damaging Het
Vmn2r97 T C 17: 18,947,299 V605A possibly damaging Het
Vwa3a T C 7: 120,776,264 V399A probably damaging Het
Wdr63 T A 3: 146,083,065 K254* probably null Het
Wnk4 G A 11: 101,268,281 R508Q probably damaging Het
Zfp217 A G 2: 170,119,210 V399A probably damaging Het
Zfp616 T A 11: 74,084,004 N457K possibly damaging Het
Other mutations in C87499
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:C87499 APN 4 88629070 missense probably benign 0.43
IGL00229:C87499 APN 4 88629053 missense probably damaging 0.99
IGL01938:C87499 APN 4 88629363 missense possibly damaging 0.90
IGL02321:C87499 APN 4 88630103 missense probably benign 0.33
IGL02351:C87499 APN 4 88627890 missense probably damaging 1.00
IGL02358:C87499 APN 4 88627890 missense probably damaging 1.00
P0005:C87499 UTSW 4 88627950 missense probably damaging 1.00
R0521:C87499 UTSW 4 88629322 missense probably damaging 0.96
R0578:C87499 UTSW 4 88634139 missense probably benign 0.01
R0600:C87499 UTSW 4 88629299 missense probably damaging 1.00
R0750:C87499 UTSW 4 88627668 missense probably benign 0.01
R1483:C87499 UTSW 4 88628834 missense probably damaging 1.00
R1502:C87499 UTSW 4 88628032 missense probably benign 0.00
R1911:C87499 UTSW 4 88630072 missense possibly damaging 0.93
R2204:C87499 UTSW 4 88628118 missense probably damaging 0.99
R2507:C87499 UTSW 4 88629211 missense possibly damaging 0.89
R2512:C87499 UTSW 4 88628958 missense probably damaging 0.99
R4299:C87499 UTSW 4 88628182 missense probably damaging 0.97
R4498:C87499 UTSW 4 88628892 splice site probably null
R4656:C87499 UTSW 4 88629965 missense probably benign 0.41
R4787:C87499 UTSW 4 88629213 nonsense probably null
R4823:C87499 UTSW 4 88629215 missense probably damaging 1.00
R4885:C87499 UTSW 4 88627982 missense possibly damaging 0.50
R4967:C87499 UTSW 4 88629195 missense probably damaging 1.00
R5229:C87499 UTSW 4 88630135 missense possibly damaging 0.92
R5426:C87499 UTSW 4 88629410 intron probably benign
R5520:C87499 UTSW 4 88630040 missense probably damaging 1.00
R5574:C87499 UTSW 4 88628043 missense probably benign 0.10
R5596:C87499 UTSW 4 88630055 missense probably damaging 1.00
R6282:C87499 UTSW 4 88630054 missense probably damaging 1.00
R6366:C87499 UTSW 4 88628865 missense probably damaging 0.99
R6808:C87499 UTSW 4 88630054 missense probably damaging 1.00
R6866:C87499 UTSW 4 88627740 missense probably damaging 1.00
R7105:C87499 UTSW 4 88630102 missense probably damaging 0.98
R7117:C87499 UTSW 4 88628958 missense probably damaging 0.99
R7319:C87499 UTSW 4 88629947 missense probably benign 0.25
R7345:C87499 UTSW 4 88628179 missense possibly damaging 0.88
R7399:C87499 UTSW 4 88627965 missense probably benign 0.01
R7626:C87499 UTSW 4 88630042 missense probably damaging 1.00
R7751:C87499 UTSW 4 88629119 missense probably benign 0.05
R8044:C87499 UTSW 4 88629975 missense possibly damaging 0.47
R8849:C87499 UTSW 4 88627777 missense probably benign 0.03
RF012:C87499 UTSW 4 88627769 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGTACTCCCTAGCTTGAGGAGG -3'
(R):5'- ACATACTTGTTGCAGTGGGC -3'

Sequencing Primer
(F):5'- GAGATGTCTTCTTACCTGAGGCATTC -3'
(R):5'- CTGAGCAGAGAAAAGATTCCATTC -3'
Posted On2016-04-27