Incidental Mutation 'R4996:Micall2'
Institutional Source Beutler Lab
Gene Symbol Micall2
Ensembl Gene ENSMUSG00000036718
Gene NameMICAL-like 2
SynonymsA930021H16Rik, Jrab, MICAL-L2
MMRRC Submission 042590-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R4996 (G1)
Quality Score225
Status Not validated
Chromosomal Location139706696-139736336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139710589 bp
Amino Acid Change Serine to Proline at position 729 (S729P)
Ref Sequence ENSEMBL: ENSMUSP00000127937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044642] [ENSMUST00000170773]
Predicted Effect unknown
Transcript: ENSMUST00000044642
AA Change: S812P
SMART Domains Protein: ENSMUSP00000039707
Gene: ENSMUSG00000036718
AA Change: S812P

CH 3 102 4.34e-20 SMART
LIM 187 241 1.62e-5 SMART
low complexity region 242 253 N/A INTRINSIC
low complexity region 326 344 N/A INTRINSIC
low complexity region 428 489 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 755 770 N/A INTRINSIC
DUF3585 840 980 3.1e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164584
Predicted Effect probably benign
Transcript: ENSMUST00000165645
Predicted Effect probably benign
Transcript: ENSMUST00000170773
AA Change: S729P

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127937
Gene: ENSMUSG00000036718
AA Change: S729P

SCOP:d1bkra_ 1 25 9e-5 SMART
Blast:DUF3585 1 45 2e-7 BLAST
LIM 104 158 1.62e-5 SMART
low complexity region 159 170 N/A INTRINSIC
low complexity region 243 261 N/A INTRINSIC
low complexity region 345 406 N/A INTRINSIC
low complexity region 419 435 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
DUF3585 757 897 3.1e-63 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Actl11 A G 9: 107,931,735 I1086V possibly damaging Het
Adgrv1 T C 13: 81,578,734 S500G probably benign Het
Ahcyl1 A T 3: 107,668,287 V394E probably damaging Het
Alg9 T C 9: 50,808,705 F494L probably damaging Het
Ankrd55 C A 13: 112,356,088 D264E possibly damaging Het
Asb14 A G 14: 26,912,116 N426S possibly damaging Het
Atm A T 9: 53,524,507 F168I probably benign Het
Atp13a4 A T 16: 29,472,004 I209N probably damaging Het
BB014433 A T 8: 15,042,166 L229Q probably benign Het
C130026I21Rik G T 1: 85,247,094 A240E probably benign Het
Calml3 T C 13: 3,804,142 D21G probably damaging Het
Capn10 A G 1: 92,945,136 N528S probably damaging Het
Ccnl2 T A 4: 155,813,524 D141E possibly damaging Het
Cd163 A G 6: 124,319,147 I817V probably benign Het
Cgnl1 CTTGCCCAGGTT CTT 9: 71,724,826 probably benign Het
Cln6 T A 9: 62,850,655 I232N probably damaging Het
Col22a1 A C 15: 72,007,161 V49G probably damaging Het
Csmd1 A T 8: 15,910,452 M3321K probably damaging Het
Cyp2u1 T A 3: 131,298,284 M196L probably benign Het
Dlec1 T G 9: 119,146,050 L1566R probably damaging Het
Dnajc3 A G 14: 118,972,427 T305A probably benign Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Efhd1 G T 1: 87,264,558 G37W possibly damaging Het
Exph5 G C 9: 53,375,610 E1330D possibly damaging Het
Fam207a A T 10: 77,515,533 W14R probably null Het
Fbln2 A T 6: 91,266,010 Y913F probably benign Het
Fmnl1 G A 11: 103,182,656 S167N possibly damaging Het
Frs3 A G 17: 47,701,710 E114G probably damaging Het
Gm960 T A 19: 4,626,084 K673N probably benign Het
Gmpr2 T C 14: 55,676,795 I169T probably damaging Het
Gria2 A G 3: 80,707,141 S531P probably damaging Het
Hace1 G A 10: 45,649,950 A296T probably benign Het
Hrasls G A 16: 29,217,704 W31* probably null Het
Inhbb A C 1: 119,420,818 L90R probably damaging Het
Insr C T 8: 3,192,665 R18Q probably null Het
Kdm6b G T 11: 69,405,731 P570Q probably damaging Het
Lama3 T C 18: 12,518,743 V1803A probably benign Het
Lpin3 T A 2: 160,905,287 L811Q probably damaging Het
Lrrc8e C T 8: 4,235,166 L464F probably damaging Het
Naca C T 10: 128,042,429 probably benign Het
Nav1 A T 1: 135,465,971 S1010T probably damaging Het
Nefm T C 14: 68,121,121 probably benign Het
Nlrp9c A T 7: 26,385,747 F136I possibly damaging Het
Nup210 A T 6: 91,053,436 F137Y probably benign Het
Olfr1079 T C 2: 86,538,271 I215V probably benign Het
Olfr402 A G 11: 74,155,331 H59R probably damaging Het
Olfr98 A G 17: 37,262,867 S266P probably benign Het
Otog C A 7: 46,298,606 H2344N possibly damaging Het
Otog C A 7: 46,305,510 C517* probably null Het
Pcdhac1 C T 18: 37,092,527 Q798* probably null Het
Pdhx T C 2: 103,030,312 D330G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Pgr C A 9: 8,900,913 P149Q probably damaging Het
Ppm1h A T 10: 122,941,340 I504F probably damaging Het
Ppp6r3 A G 19: 3,473,833 S556P probably damaging Het
Ranbp9 G A 13: 43,425,094 Q168* probably null Het
Relb A T 7: 19,615,603 L259Q probably benign Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Rgcc T C 14: 79,290,276 D125G possibly damaging Het
Rmnd5b A G 11: 51,627,908 V86A probably damaging Het
Slc15a5 G A 6: 138,043,585 T250M probably damaging Het
Slc7a2 A T 8: 40,912,562 K477* probably null Het
Smc2 T A 4: 52,461,042 probably null Het
Sox5 A T 6: 144,028,344 L226* probably null Het
Syne2 A G 12: 75,943,950 E1903G possibly damaging Het
Tenm3 A T 8: 48,235,826 I2226N probably damaging Het
Tmtc3 A T 10: 100,447,224 I823N probably damaging Het
Tor3a T C 1: 156,655,772 Y360C probably damaging Het
Trpc3 T C 3: 36,662,818 E357G probably benign Het
Ttc30a1 C T 2: 75,979,922 G606S probably benign Het
Tubgcp6 A T 15: 89,103,490 N1093K possibly damaging Het
Vmn1r64 T A 7: 5,884,053 T164S probably benign Het
Vmn2r40 T A 7: 8,908,167 Q709L probably damaging Het
Vmn2r81 A T 10: 79,293,413 I713L probably benign Het
Washc5 T C 15: 59,333,635 T686A probably benign Het
Other mutations in Micall2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Micall2 APN 5 139717556 critical splice acceptor site probably null
IGL00496:Micall2 APN 5 139716328 missense probably benign 0.01
IGL02641:Micall2 APN 5 139719339 missense probably damaging 1.00
IGL03245:Micall2 APN 5 139719259 missense probably damaging 1.00
IGL03252:Micall2 APN 5 139716726 missense probably benign 0.01
R1214:Micall2 UTSW 5 139711641 missense probably damaging 0.97
R1468:Micall2 UTSW 5 139719342 missense probably damaging 1.00
R1468:Micall2 UTSW 5 139719342 missense probably damaging 1.00
R1831:Micall2 UTSW 5 139716753 missense probably benign 0.09
R1833:Micall2 UTSW 5 139716753 missense probably benign 0.09
R1969:Micall2 UTSW 5 139736130 missense probably damaging 1.00
R2023:Micall2 UTSW 5 139717511 missense possibly damaging 0.51
R2060:Micall2 UTSW 5 139711562 missense probably damaging 0.98
R2330:Micall2 UTSW 5 139717515 missense probably damaging 1.00
R3820:Micall2 UTSW 5 139715856 missense possibly damaging 0.92
R4299:Micall2 UTSW 5 139709471 intron probably benign
R4334:Micall2 UTSW 5 139713350 missense probably damaging 1.00
R4451:Micall2 UTSW 5 139707097 missense probably damaging 1.00
R4769:Micall2 UTSW 5 139706886 missense probably damaging 0.97
R4911:Micall2 UTSW 5 139716825 missense probably damaging 1.00
R5118:Micall2 UTSW 5 139716447 missense probably damaging 1.00
R5155:Micall2 UTSW 5 139710231 missense probably damaging 1.00
R5475:Micall2 UTSW 5 139716469 missense probably damaging 1.00
R5750:Micall2 UTSW 5 139715701 splice site probably null
R5998:Micall2 UTSW 5 139706911 critical splice acceptor site probably null
R6181:Micall2 UTSW 5 139716751 missense probably benign 0.41
R6852:Micall2 UTSW 5 139715793 missense possibly damaging 0.90
R7046:Micall2 UTSW 5 139708944 unclassified probably benign
R7395:Micall2 UTSW 5 139716369 missense possibly damaging 0.78
R8514:Micall2 UTSW 5 139716222 missense probably damaging 1.00
Z1088:Micall2 UTSW 5 139706894 missense probably damaging 1.00
Z1088:Micall2 UTSW 5 139716295 missense probably benign 0.12
Z1177:Micall2 UTSW 5 139710302 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-05-10