Incidental Mutation 'R5080:Osbpl6'
ID387063
Institutional Source Beutler Lab
Gene Symbol Osbpl6
Ensembl Gene ENSMUSG00000042359
Gene Nameoxysterol binding protein-like 6
Synonyms1110062M20Rik, ORP-6
MMRRC Submission 042669-MU
Accession Numbers

Genbank: NM_145525; MGI: 2139014

Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R5080 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location76406508-76600647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76524085 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 15 (S15P)
Ref Sequence ENSEMBL: ENSMUSP00000107561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077972] [ENSMUST00000111929] [ENSMUST00000111930]
Predicted Effect probably benign
Transcript: ENSMUST00000077972
AA Change: S15P

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077123
Gene: ENSMUSG00000042359
AA Change: S15P

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
low complexity region 537 550 N/A INTRINSIC
Pfam:Oxysterol_BP 603 951 1.4e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111929
AA Change: S15P

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107560
Gene: ENSMUSG00000042359
AA Change: S15P

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
coiled coil region 441 472 N/A INTRINSIC
low complexity region 529 542 N/A INTRINSIC
Pfam:Oxysterol_BP 595 944 1.1e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111930
AA Change: S15P

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107561
Gene: ENSMUSG00000042359
AA Change: S15P

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
coiled coil region 410 441 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
Pfam:Oxysterol_BP 564 913 1e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128034
Meta Mutation Damage Score 0.0751 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

 

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 G A 14: 103,049,308 G16S possibly damaging Het
Adcy4 A T 14: 55,772,375 M740K probably damaging Het
Atp1a2 T C 1: 172,284,445 probably benign Het
Atrn T A 2: 130,970,124 I663N possibly damaging Het
Cacna2d1 T C 5: 16,362,396 probably null Het
Carf C A 1: 60,150,613 Q631K probably damaging Het
Ces1d T C 8: 93,181,547 D306G probably benign Het
Corin T A 5: 72,353,851 probably benign Het
Csf1r T C 18: 61,124,301 F575L probably damaging Het
Dcaf6 T C 1: 165,420,121 D181G probably damaging Het
Dnah11 C T 12: 118,198,830 M1I probably null Het
Dnah7b C T 1: 46,182,380 R1215* probably null Het
Dpp3 T A 19: 4,915,080 D464V probably benign Het
Drosha C A 15: 12,842,143 A344D probably benign Het
Fam160b1 A T 19: 57,373,281 K134I probably damaging Het
Fat3 G T 9: 15,999,338 S1789R probably benign Het
Frg2f1 T C 4: 119,531,033 T90A possibly damaging Het
Frrs1 T C 3: 116,902,936 I544T probably benign Het
Gm10020 A G 15: 52,478,050 noncoding transcript Het
Gm20939 T C 17: 94,876,991 C356R probably damaging Het
Ifi206 T A 1: 173,473,848 I755F possibly damaging Het
Kntc1 T A 5: 123,762,586 V249E possibly damaging Het
Lama5 A T 2: 180,207,200 L230* probably null Het
Lce1e C T 3: 92,707,830 C70Y unknown Het
Ltbp2 T C 12: 84,803,864 N892S probably damaging Het
Mfsd4b5 T A 10: 39,970,574 M337L probably damaging Het
Noxo1 T A 17: 24,699,357 C164S probably damaging Het
Olfr10 G T 11: 49,318,087 M180I probably benign Het
Olfr1052 G A 2: 86,297,914 V33M probably benign Het
Pcdh17 A G 14: 84,533,310 Y1076C probably benign Het
Pik3c2a T A 7: 116,348,274 H1391L probably damaging Het
Plcg2 A G 8: 117,590,003 Y573C probably benign Het
Prpf3 T A 3: 95,833,797 H600L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Serpini1 T C 3: 75,616,660 S192P probably damaging Het
Sp110 G T 1: 85,596,055 Y18* probably null Het
Stard6 A T 18: 70,496,222 I126F probably damaging Het
Strip2 T A 6: 29,945,593 L660H probably damaging Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tns1 G T 1: 73,952,940 P860T probably damaging Het
Togaram1 T C 12: 64,983,403 S994P probably benign Het
Tomm34 G A 2: 164,070,896 probably benign Het
Trank1 G A 9: 111,389,221 E1890K probably damaging Het
Wasf3 C T 5: 146,461,097 H225Y probably benign Het
Wdr37 A T 13: 8,847,674 probably null Het
Zbtb7c A C 18: 76,137,342 D167A probably benign Het
Zkscan4 A G 13: 21,481,328 T158A probably benign Het
Other mutations in Osbpl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Osbpl6 APN 2 76590439 missense probably damaging 1.00
IGL01109:Osbpl6 APN 2 76549527 missense probably damaging 1.00
IGL01288:Osbpl6 APN 2 76564823 missense probably damaging 0.98
IGL01717:Osbpl6 APN 2 76588594 missense probably damaging 1.00
IGL02146:Osbpl6 APN 2 76549750 missense possibly damaging 0.90
IGL02597:Osbpl6 APN 2 76555974 nonsense probably null
IGL02652:Osbpl6 APN 2 76593454 missense probably damaging 1.00
IGL02867:Osbpl6 APN 2 76595870 splice site probably benign
IGL03143:Osbpl6 APN 2 76548372 missense probably damaging 1.00
3-1:Osbpl6 UTSW 2 76586151 missense probably damaging 1.00
R0085:Osbpl6 UTSW 2 76593414 missense probably benign 0.30
R0201:Osbpl6 UTSW 2 76546042 missense possibly damaging 0.92
R0573:Osbpl6 UTSW 2 76590391 missense probably damaging 1.00
R0644:Osbpl6 UTSW 2 76594840 missense probably damaging 1.00
R0855:Osbpl6 UTSW 2 76585133 missense probably damaging 1.00
R0855:Osbpl6 UTSW 2 76591839 missense probably damaging 1.00
R1017:Osbpl6 UTSW 2 76549719 missense probably damaging 1.00
R1459:Osbpl6 UTSW 2 76555065 missense probably benign 0.01
R1505:Osbpl6 UTSW 2 76579242 missense probably damaging 1.00
R1588:Osbpl6 UTSW 2 76579216 missense probably benign
R1786:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R1863:Osbpl6 UTSW 2 76585058 missense probably damaging 1.00
R2131:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2132:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2133:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2233:Osbpl6 UTSW 2 76586769 missense probably damaging 0.99
R2235:Osbpl6 UTSW 2 76586769 missense probably damaging 0.99
R2256:Osbpl6 UTSW 2 76584474 missense probably damaging 1.00
R2294:Osbpl6 UTSW 2 76577079 missense possibly damaging 0.81
R3023:Osbpl6 UTSW 2 76586733 missense probably damaging 1.00
R4192:Osbpl6 UTSW 2 76585229 missense probably damaging 1.00
R4544:Osbpl6 UTSW 2 76584492 missense possibly damaging 0.84
R4546:Osbpl6 UTSW 2 76584492 missense possibly damaging 0.84
R4664:Osbpl6 UTSW 2 76568208 missense probably benign 0.02
R4764:Osbpl6 UTSW 2 76546000 missense probably damaging 1.00
R4884:Osbpl6 UTSW 2 76549539 missense probably damaging 1.00
R5430:Osbpl6 UTSW 2 76586138 missense probably damaging 1.00
R5614:Osbpl6 UTSW 2 76568109 missense probably damaging 1.00
R5807:Osbpl6 UTSW 2 76584513 missense probably damaging 0.98
R5956:Osbpl6 UTSW 2 76549512 missense probably damaging 1.00
R6394:Osbpl6 UTSW 2 76555954 missense probably benign 0.00
R6430:Osbpl6 UTSW 2 76579276 missense probably damaging 1.00
R6450:Osbpl6 UTSW 2 76564830 missense possibly damaging 0.90
R7116:Osbpl6 UTSW 2 76595881 missense probably benign 0.06
R7385:Osbpl6 UTSW 2 76549450 missense probably damaging 1.00
R7422:Osbpl6 UTSW 2 76593386 missense probably damaging 1.00
R7561:Osbpl6 UTSW 2 76586154 missense probably damaging 1.00
R7829:Osbpl6 UTSW 2 76593387 missense probably damaging 1.00
Z31818:Osbpl6 UTSW 2 76555082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGTGGCCTGAGTTTTC -3'
(R):5'- AGGGTAGCAGCTTCTCACTATC -3'

Sequencing Primer
(F):5'- TCCTAGTCCAGTCTGATCCGAGG -3'
(R):5'- TAGCAGCTTCTCACTATCAGGCATAG -3'
Posted On2016-06-06