Incidental Mutation 'R5057:Tll2'
ID390990
Institutional Source Beutler Lab
Gene Symbol Tll2
Ensembl Gene ENSMUSG00000025013
Gene Nametolloid-like 2
Synonyms
MMRRC Submission 042647-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R5057 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location41083981-41206774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41117266 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 358 (V358A)
Ref Sequence ENSEMBL: ENSMUSP00000125973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025986] [ENSMUST00000169941]
Predicted Effect probably benign
Transcript: ENSMUST00000025986
AA Change: V375A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000025986
Gene: ENSMUSG00000025013
AA Change: V375A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
ZnMc 152 294 1.15e-54 SMART
CUB 348 460 7.69e-44 SMART
CUB 461 573 8.69e-52 SMART
EGF_CA 573 614 1.26e-11 SMART
CUB 617 729 3.99e-51 SMART
EGF_CA 729 769 5.92e-8 SMART
CUB 773 885 3.08e-43 SMART
CUB 886 1002 2.25e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169941
AA Change: V358A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125973
Gene: ENSMUSG00000025013
AA Change: V358A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
ZnMc 152 294 1.15e-54 SMART
CUB 331 443 7.69e-44 SMART
CUB 444 556 8.69e-52 SMART
EGF_CA 556 597 1.26e-11 SMART
CUB 600 712 3.99e-51 SMART
EGF_CA 712 752 5.92e-8 SMART
CUB 756 868 3.08e-43 SMART
CUB 869 985 2.25e-36 SMART
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 97% (118/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased muscle weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,225,421 F207I probably benign Het
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Acad12 T A 5: 121,610,089 T89S probably benign Het
Adgb A G 10: 10,357,978 C1252R probably benign Het
Ankef1 A G 2: 136,550,360 probably null Het
Ankfy1 T C 11: 72,759,919 L976P probably damaging Het
Ankib1 T A 5: 3,734,011 I322F possibly damaging Het
Ankrd61 T A 5: 143,894,795 T64S probably benign Het
Anxa6 T G 11: 55,001,236 E298A possibly damaging Het
Apc2 A G 10: 80,309,069 S605G probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
Bptf A T 11: 107,082,528 F693L probably damaging Het
Cacng4 A G 11: 107,794,371 Y32H probably damaging Het
Ccdc50 T A 16: 27,438,342 D252E probably benign Het
Ccdc92b C A 11: 74,638,150 T160K probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh22 C A 2: 165,116,143 V635F probably damaging Het
Cenpe G T 3: 135,220,313 A243S probably benign Het
Cep295 A T 9: 15,322,683 H2272Q probably benign Het
Cgnl1 A T 9: 71,724,794 V425D probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Cntnap5a C T 1: 115,685,213 T26I probably benign Het
Col6a3 T C 1: 90,816,130 K165R possibly damaging Het
Copb1 A T 7: 114,226,762 N662K probably benign Het
Crybg1 T A 10: 43,989,108 R1458* probably null Het
Cspp1 T A 1: 10,074,961 probably benign Het
Dhtkd1 A G 2: 5,919,513 C430R probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Ephb3 A G 16: 21,220,447 D351G probably damaging Het
Exd2 T A 12: 80,496,790 N582K probably damaging Het
Fam161a T A 11: 23,020,397 C192S probably damaging Het
Fbn1 A G 2: 125,466,695 V149A probably benign Het
Fbxw16 A G 9: 109,441,164 S170P probably damaging Het
Fndc1 T A 17: 7,771,970 R965* probably null Het
Frem2 T C 3: 53,535,196 D2640G probably benign Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm44501 A G 17: 40,578,672 T26A probably benign Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5045 A T 15: 59,211,155 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpsm1 G A 2: 26,325,357 R277Q probably damaging Het
Inmt T A 6: 55,174,898 H29L probably benign Het
Insrr T A 3: 87,815,265 C1265S probably benign Het
Kctd12 A G 14: 102,981,609 F278L possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lag3 T A 6: 124,905,355 I393F possibly damaging Het
Lama2 C T 10: 27,164,986 C1447Y probably damaging Het
Lama3 G A 18: 12,531,948 G2275S probably null Het
Lrrc17 A T 5: 21,575,309 H427L probably benign Het
Med13l T A 5: 118,718,493 S164T probably damaging Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Myo5c A T 9: 75,300,873 T1630S probably damaging Het
Nbeal2 A T 9: 110,631,005 N1848K probably damaging Het
Ncor2 A T 5: 125,048,066 V307E possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nexmif A T X: 104,087,350 N320K probably damaging Het
Nipal3 T A 4: 135,466,856 I289F probably damaging Het
Nrg4 A G 9: 55,282,596 probably benign Het
Nrxn3 A T 12: 89,255,034 I528F probably damaging Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr748 A C 14: 50,711,212 N294T probably damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcnx2 T C 8: 125,855,191 I935M possibly damaging Het
Pik3c2a G T 7: 116,376,283 T683K possibly damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkd1l2 G A 8: 117,055,008 T766I probably benign Het
Polr3c C A 3: 96,712,057 L508F probably damaging Het
Por A G 5: 135,730,902 D189G probably damaging Het
Prim2 A T 1: 33,630,360 L178* probably null Het
Prima1 C A 12: 103,202,605 probably null Het
Ptpn21 G A 12: 98,679,407 R1091C probably damaging Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Rad21 A T 15: 51,966,706 I503K probably benign Het
Rbm12 A T 2: 156,096,886 C489S probably benign Het
Rpl10a A T 17: 28,330,633 H140L probably benign Het
Rtbdn T C 8: 84,955,009 F143S probably damaging Het
Scamp3 T A 3: 89,182,293 probably benign Het
Setd5 A G 6: 113,137,961 S848G probably damaging Het
Sez6 T C 11: 77,973,153 V487A probably damaging Het
Shc2 G A 10: 79,623,872 P413S probably benign Het
Sipa1l3 T C 7: 29,371,193 N966S probably damaging Het
Slc39a8 A G 3: 135,849,029 E78G probably benign Het
Slc8a3 A G 12: 81,199,558 V900A probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Spire2 G A 8: 123,358,201 R260H probably damaging Het
Stk39 T A 2: 68,220,948 I518F probably damaging Het
Tardbp T A 4: 148,619,356 probably null Het
Tep1 A G 14: 50,828,999 Y2335H probably benign Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tnfsf9 A G 17: 57,105,444 T5A probably benign Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim5 A G 7: 104,265,423 Y480H probably damaging Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttn T A 2: 76,747,035 K22759* probably null Het
Ttn C A 2: 76,918,644 L4020F probably benign Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Ube3b T C 5: 114,406,257 F572L probably benign Het
Ubr5 A G 15: 38,004,109 V1332A probably damaging Het
Ubtd2 C A 11: 32,516,320 R180S probably damaging Het
Ubtf A G 11: 102,307,087 S673P probably damaging Het
Ubtfl1 A T 9: 18,409,191 D5V possibly damaging Het
Usp17la G A 7: 104,861,123 V312I possibly damaging Het
Usp17ld G T 7: 103,250,448 H426N probably benign Het
Usp34 A G 11: 23,458,086 probably benign Het
Vmn1r199 A T 13: 22,383,405 T290S possibly damaging Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vmn2r6 T A 3: 64,537,786 K839N probably damaging Het
Vmn2r65 A G 7: 84,940,611 I699T probably damaging Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Wdr60 A T 12: 116,213,413 N856K probably benign Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Other mutations in Tll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Tll2 APN 19 41086366 missense probably benign 0.01
IGL02028:Tll2 APN 19 41098649 nonsense probably null
IGL02146:Tll2 APN 19 41097837 missense probably benign 0.00
IGL02192:Tll2 APN 19 41086263 missense possibly damaging 0.73
IGL02544:Tll2 APN 19 41135965 missense probably damaging 1.00
PIT4677001:Tll2 UTSW 19 41130558 missense probably benign 0.14
R0141:Tll2 UTSW 19 41097912 missense probably damaging 1.00
R0372:Tll2 UTSW 19 41183313 critical splice acceptor site probably null
R0393:Tll2 UTSW 19 41088826 missense possibly damaging 0.95
R0402:Tll2 UTSW 19 41098693 missense possibly damaging 0.56
R0613:Tll2 UTSW 19 41104990 missense probably damaging 0.97
R0756:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R0757:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R0790:Tll2 UTSW 19 41103850 missense probably damaging 0.98
R0834:Tll2 UTSW 19 41113073 missense probably damaging 1.00
R0843:Tll2 UTSW 19 41128463 splice site probably null
R1014:Tll2 UTSW 19 41103851 missense probably damaging 1.00
R1178:Tll2 UTSW 19 41092847 missense probably damaging 1.00
R1233:Tll2 UTSW 19 41095984 missense possibly damaging 0.79
R1364:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1367:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1368:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1519:Tll2 UTSW 19 41086400 missense probably benign 0.17
R1894:Tll2 UTSW 19 41088671 critical splice donor site probably null
R1896:Tll2 UTSW 19 41113059 missense probably benign 0.44
R1917:Tll2 UTSW 19 41128497 missense possibly damaging 0.83
R2170:Tll2 UTSW 19 41183275 missense probably damaging 1.00
R4433:Tll2 UTSW 19 41121348 missense probably benign 0.03
R4617:Tll2 UTSW 19 41098636 missense probably benign 0.31
R4831:Tll2 UTSW 19 41130512 missense probably damaging 1.00
R5119:Tll2 UTSW 19 41130509 missense possibly damaging 0.48
R5194:Tll2 UTSW 19 41095897 missense probably damaging 1.00
R5280:Tll2 UTSW 19 41117257 missense possibly damaging 0.87
R5602:Tll2 UTSW 19 41104981 missense possibly damaging 0.63
R5800:Tll2 UTSW 19 41104934 missense probably benign 0.10
R6223:Tll2 UTSW 19 41135952 missense possibly damaging 0.54
R7047:Tll2 UTSW 19 41086240 missense probably damaging 0.99
R7155:Tll2 UTSW 19 41117284 missense possibly damaging 0.72
R7213:Tll2 UTSW 19 41120227 missense probably damaging 0.97
R7231:Tll2 UTSW 19 41086234 missense probably benign 0.02
R7390:Tll2 UTSW 19 41120169 critical splice donor site probably null
R7414:Tll2 UTSW 19 41103829 missense probably damaging 0.98
X0027:Tll2 UTSW 19 41183303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATTAACTGCACAAGGGTTGGG -3'
(R):5'- GCTTTCACTTCACAGGCCTG -3'

Sequencing Primer
(F):5'- ACAAGGGTTGGGTCCTCCTAC -3'
(R):5'- GACAGGAAACTTTTCGGC -3'
Posted On2016-06-06