Incidental Mutation 'R5280:Tll2'
ID404185
Institutional Source Beutler Lab
Gene Symbol Tll2
Ensembl Gene ENSMUSG00000025013
Gene Nametolloid-like 2
Synonyms
MMRRC Submission 042840-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R5280 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41083981-41206774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41117257 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 361 (I361T)
Ref Sequence ENSEMBL: ENSMUSP00000125973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025986] [ENSMUST00000169941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025986
AA Change: I378T

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025986
Gene: ENSMUSG00000025013
AA Change: I378T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
ZnMc 152 294 1.15e-54 SMART
CUB 348 460 7.69e-44 SMART
CUB 461 573 8.69e-52 SMART
EGF_CA 573 614 1.26e-11 SMART
CUB 617 729 3.99e-51 SMART
EGF_CA 729 769 5.92e-8 SMART
CUB 773 885 3.08e-43 SMART
CUB 886 1002 2.25e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169941
AA Change: I361T

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125973
Gene: ENSMUSG00000025013
AA Change: I361T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
ZnMc 152 294 1.15e-54 SMART
CUB 331 443 7.69e-44 SMART
CUB 444 556 8.69e-52 SMART
EGF_CA 556 597 1.26e-11 SMART
CUB 600 712 3.99e-51 SMART
EGF_CA 712 752 5.92e-8 SMART
CUB 756 868 3.08e-43 SMART
CUB 869 985 2.25e-36 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased muscle weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 C T 17: 43,426,334 T218I probably damaging Het
Adgrv1 C A 13: 81,397,465 S5567I possibly damaging Het
Alpk1 T C 3: 127,681,164 T397A probably benign Het
Atp9a T A 2: 168,639,988 Y880F possibly damaging Het
Celsr1 T C 15: 85,930,546 T1905A probably benign Het
Chd8 G A 14: 52,205,125 A656V possibly damaging Het
Dffa A G 4: 149,117,934 N265S probably benign Het
Frrs1 A G 3: 116,880,896 D109G probably benign Het
Gm20821 A T Y: 9,783,963 K195M probably damaging Het
Ifi207 A T 1: 173,730,304 N289K unknown Het
Kank1 T C 19: 25,411,305 F781L probably benign Het
Lrba A T 3: 86,325,022 M759L possibly damaging Het
Lrp8 A G 4: 107,854,321 Y307C probably damaging Het
Neb T C 2: 52,147,156 H6847R probably damaging Het
Olfr599 T C 7: 103,338,501 V149A probably benign Het
Olfr703 G A 7: 106,844,695 C28Y probably benign Het
Pcdha5 C A 18: 36,961,702 Y421* probably null Het
Pclo T A 5: 14,540,717 D1010E unknown Het
Pld2 A T 11: 70,552,759 D449V probably damaging Het
Ppfia1 C A 7: 144,485,095 M1032I possibly damaging Het
Prickle2 C A 6: 92,376,210 L758F probably damaging Het
Sarm1 A G 11: 78,483,476 V564A probably damaging Het
Taf1b C A 12: 24,549,438 F398L probably benign Het
Tmem260 T C 14: 48,505,259 V517A probably benign Het
Usp24 A G 4: 106,341,214 K106E probably benign Het
Vcan C A 13: 89,690,286 V2380F probably benign Het
Vmn2r65 A G 7: 84,946,334 S381P probably damaging Het
Vmn2r73 T C 7: 85,857,947 D719G probably damaging Het
Wdr5b T C 16: 36,041,832 V107A probably benign Het
Wdr7 G T 18: 63,987,312 V1475F probably benign Het
Ythdc2 A G 18: 44,860,621 D911G probably damaging Het
Zbtb32 T A 7: 30,590,204 E11V probably damaging Het
Zfp563 T G 17: 33,104,838 Y136D probably damaging Het
Other mutations in Tll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Tll2 APN 19 41086366 missense probably benign 0.01
IGL02028:Tll2 APN 19 41098649 nonsense probably null
IGL02146:Tll2 APN 19 41097837 missense probably benign 0.00
IGL02192:Tll2 APN 19 41086263 missense possibly damaging 0.73
IGL02544:Tll2 APN 19 41135965 missense probably damaging 1.00
PIT4677001:Tll2 UTSW 19 41130558 missense probably benign 0.14
R0141:Tll2 UTSW 19 41097912 missense probably damaging 1.00
R0372:Tll2 UTSW 19 41183313 critical splice acceptor site probably null
R0393:Tll2 UTSW 19 41088826 missense possibly damaging 0.95
R0402:Tll2 UTSW 19 41098693 missense possibly damaging 0.56
R0613:Tll2 UTSW 19 41104990 missense probably damaging 0.97
R0756:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R0757:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R0790:Tll2 UTSW 19 41103850 missense probably damaging 0.98
R0834:Tll2 UTSW 19 41113073 missense probably damaging 1.00
R0843:Tll2 UTSW 19 41128463 splice site probably null
R1014:Tll2 UTSW 19 41103851 missense probably damaging 1.00
R1178:Tll2 UTSW 19 41092847 missense probably damaging 1.00
R1233:Tll2 UTSW 19 41095984 missense possibly damaging 0.79
R1364:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1367:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1368:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1519:Tll2 UTSW 19 41086400 missense probably benign 0.17
R1894:Tll2 UTSW 19 41088671 critical splice donor site probably null
R1896:Tll2 UTSW 19 41113059 missense probably benign 0.44
R1917:Tll2 UTSW 19 41128497 missense possibly damaging 0.83
R2170:Tll2 UTSW 19 41183275 missense probably damaging 1.00
R4433:Tll2 UTSW 19 41121348 missense probably benign 0.03
R4617:Tll2 UTSW 19 41098636 missense probably benign 0.31
R4831:Tll2 UTSW 19 41130512 missense probably damaging 1.00
R5057:Tll2 UTSW 19 41117266 missense probably benign 0.02
R5119:Tll2 UTSW 19 41130509 missense possibly damaging 0.48
R5194:Tll2 UTSW 19 41095897 missense probably damaging 1.00
R5602:Tll2 UTSW 19 41104981 missense possibly damaging 0.63
R5800:Tll2 UTSW 19 41104934 missense probably benign 0.10
R6223:Tll2 UTSW 19 41135952 missense possibly damaging 0.54
R7047:Tll2 UTSW 19 41086240 missense probably damaging 0.99
R7155:Tll2 UTSW 19 41117284 missense possibly damaging 0.72
R7213:Tll2 UTSW 19 41120227 missense probably damaging 0.97
R7231:Tll2 UTSW 19 41086234 missense probably benign 0.02
R7390:Tll2 UTSW 19 41120169 critical splice donor site probably null
R7414:Tll2 UTSW 19 41103829 missense probably damaging 0.98
X0027:Tll2 UTSW 19 41183303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTGCACAAGGGTTGGG -3'
(R):5'- AAGGCTTTCACTTCACAGGC -3'

Sequencing Primer
(F):5'- ACAAGGGTTGGGTCCTCCTAC -3'
(R):5'- GGAAACTTTTCGGCACCT -3'
Posted On2016-07-22