Incidental Mutation 'R5204:Olfr609'
ID398344
Institutional Source Beutler Lab
Gene Symbol Olfr609
Ensembl Gene ENSMUSG00000046396
Gene Nameolfactory receptor 609
SynonymsMOR9-1, GA_x6K02T2PBJ9-6207735-6206776
MMRRC Submission 042779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5204 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103490025-103498062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103492540 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 113 (V113M)
Ref Sequence ENSEMBL: ENSMUSP00000149804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055787] [ENSMUST00000216075] [ENSMUST00000216360]
Predicted Effect probably damaging
Transcript: ENSMUST00000055787
AA Change: V113M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051749
Gene: ENSMUSG00000046396
AA Change: V113M

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 1.4e-119 PFAM
Pfam:7TM_GPCR_Srsx 34 169 2.2e-10 PFAM
Pfam:7tm_1 40 291 3.6e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216075
AA Change: V113M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216360
AA Change: V113M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,033,090 V289I probably benign Het
Aarsd1 A T 11: 101,406,926 L532Q probably damaging Het
Abt1 G A 13: 23,422,668 R88C probably damaging Het
Arhgef7 T A 8: 11,800,775 L129* probably null Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Bivm G C 1: 44,138,578 G346A probably damaging Het
Cav1 T C 6: 17,339,255 L102P probably damaging Het
Ccdc57 A G 11: 120,886,062 V504A possibly damaging Het
Cd7 A T 11: 121,038,034 probably null Het
Cdh3 T C 8: 106,544,239 V508A probably benign Het
Chrd A T 16: 20,736,072 I413F probably benign Het
Clec4b1 T A 6: 123,071,535 *210R probably null Het
Clock A T 5: 76,243,170 probably null Het
Col4a2 T A 8: 11,398,651 probably null Het
Gpx7 T C 4: 108,403,315 T95A probably benign Het
Hivep3 T A 4: 120,103,856 probably null Het
Hrc A G 7: 45,335,704 Y93C possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Klhl5 G T 5: 65,131,438 L14F possibly damaging Het
Mcm6 A G 1: 128,333,638 L743P probably benign Het
Nrxn1 A T 17: 90,162,364 F57Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh20 G T 14: 88,468,915 D316E probably damaging Het
Pcdhb12 T A 18: 37,436,089 V96E probably damaging Het
Pi4ka A T 16: 17,359,045 L346M possibly damaging Het
Pkhd1l1 A C 15: 44,547,041 N2648T possibly damaging Het
Rufy1 C T 11: 50,406,434 R397Q probably damaging Het
Sema5a G T 15: 32,686,647 M968I probably benign Het
Slc33a1 A G 3: 63,963,746 Y149H probably damaging Het
Tln2 T A 9: 67,354,482 R658S probably benign Het
Tmem30c T C 16: 57,270,022 N274S possibly damaging Het
Tor3a A G 1: 156,655,700 L384P probably damaging Het
Trpm3 T A 19: 22,448,341 L20* probably null Het
Ttn T A 2: 76,730,212 I20955F probably damaging Het
Usp15 A T 10: 123,113,640 S908R probably benign Het
Zfp866 A G 8: 69,766,040 L310P probably damaging Het
Other mutations in Olfr609
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02213:Olfr609 APN 7 103492488 missense probably benign 0.05
IGL02309:Olfr609 APN 7 103491999 missense probably damaging 0.99
R0782:Olfr609 UTSW 7 103492515 missense probably damaging 0.99
R0988:Olfr609 UTSW 7 103492747 missense probably damaging 1.00
R4013:Olfr609 UTSW 7 103492633 missense probably benign
R4600:Olfr609 UTSW 7 103492581 missense probably damaging 0.99
R4735:Olfr609 UTSW 7 103492060 missense possibly damaging 0.61
R4941:Olfr609 UTSW 7 103492251 missense probably damaging 1.00
R5281:Olfr609 UTSW 7 103491973 missense probably benign 0.00
R5941:Olfr609 UTSW 7 103492720 missense possibly damaging 0.95
R6319:Olfr609 UTSW 7 103492725 missense possibly damaging 0.84
R6505:Olfr609 UTSW 7 103492651 missense probably damaging 1.00
R7258:Olfr609 UTSW 7 103492589 missense probably damaging 1.00
X0065:Olfr609 UTSW 7 103491918 makesense probably null
Z1177:Olfr609 UTSW 7 103492610 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCAGCTTCATAACATCTGG -3'
(R):5'- CCTGCACCAGCCTATGTACTAC -3'

Sequencing Primer
(F):5'- CAGCTTCATAACATCTGGGTGCAG -3'
(R):5'- GTACTACTTTCTATCCATGCTTGCAG -3'
Posted On2016-07-06