Incidental Mutation 'R0454:Papolg'
Institutional Source Beutler Lab
Gene Symbol Papolg
Ensembl Gene ENSMUSG00000020273
Gene Namepoly(A) polymerase gamma
MMRRC Submission 038654-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R0454 (G1)
Quality Score220
Status Not validated
Chromosomal Location23862646-23895253 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 23879868 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020513] [ENSMUST00000102863]
Predicted Effect probably null
Transcript: ENSMUST00000020513
SMART Domains Protein: ENSMUSP00000020513
Gene: ENSMUSG00000020273

Pfam:PAP_central 20 363 1.4e-118 PFAM
Pfam:NTP_transf_2 53 174 2.8e-15 PFAM
Pfam:PAP_RNA-bind 365 431 2.4e-22 PFAM
Pfam:PAP_RNA-bind 421 506 1.2e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102863
SMART Domains Protein: ENSMUSP00000099927
Gene: ENSMUSG00000020273

Pfam:PAP_central 16 364 1.5e-111 PFAM
Pfam:NTP_transf_2 89 174 9.2e-12 PFAM
Pfam:PAP_RNA-bind 365 429 6.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150711
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(A) polymerase family which catalyzes template-independent extension of the 3' end of a DNA/RNA strand. This enzyme shares 60% identity to the well characterized poly(A) polymerase II (PAPII) at the amino acid level. These two enzymes have similar organization of structural and functional domains. This enzyme is exclusively localized in the nucleus and exhibits both nonspecific and CPSF (cleavage and polyadenylation specificity factor)/AAUAAA-dependent polyadenylation activity. This gene is located on chromosome 2 in contrast to the PAPII gene, which is located on chromosome 14. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik A G 5: 118,255,821 E88G possibly damaging Het
4930447F04Rik T C X: 66,303,668 E91G unknown Het
Acot1 A G 12: 84,017,339 Q407R probably benign Het
Adcy10 T A 1: 165,570,728 Y1465N probably damaging Het
Ahsa2 T A 11: 23,490,702 I249F probably damaging Het
Arhgap10 T C 8: 77,250,965 N721S probably damaging Het
Arrdc4 T G 7: 68,741,871 E216A probably damaging Het
Axin1 T C 17: 26,173,663 V306A probably benign Het
BC005561 T G 5: 104,518,211 S200A probably benign Het
Cct3 T C 3: 88,302,866 probably null Het
Cfap58 G A 19: 47,974,680 probably null Het
Chd9 T C 8: 90,973,231 S49P possibly damaging Het
Clcn2 C A 16: 20,710,428 probably null Het
Col26a1 T C 5: 136,754,193 N286D probably benign Het
Cpt1b T A 15: 89,424,393 I111F possibly damaging Het
Cyp4f16 T A 17: 32,537,087 I30N probably damaging Het
Ddc T G 11: 11,880,587 D19A possibly damaging Het
Depdc1a T A 3: 159,516,900 probably null Het
Evc2 T A 5: 37,417,484 C1028S possibly damaging Het
Fam228a T C 12: 4,731,457 E134G probably damaging Het
Fasl T C 1: 161,787,954 E111G probably benign Het
Fbxw10 A G 11: 62,876,738 N800S possibly damaging Het
Fras1 T C 5: 96,762,665 S3318P probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gad1 T A 2: 70,579,201 M212K probably damaging Het
Gm17455 T G 10: 60,402,973 S6A probably benign Het
Grm5 T C 7: 88,130,789 S1146P probably damaging Het
Gsn T C 2: 35,304,639 L649P probably damaging Het
H2-DMb1 A G 17: 34,155,711 T112A probably benign Het
Hcn3 T A 3: 89,152,894 I148F probably damaging Het
Hdac10 T C 15: 89,125,758 probably null Het
Hk3 C A 13: 55,008,705 D619Y probably damaging Het
Ifi44 T A 3: 151,745,497 R272S possibly damaging Het
Il1rap A C 16: 26,698,875 D275A probably damaging Het
Itgam A T 7: 128,107,980 N660I probably benign Het
Itpr3 T C 17: 27,113,819 M1853T probably benign Het
Lrmp A G 6: 145,167,984 R293G possibly damaging Het
Lrrc8c A C 5: 105,607,099 K247Q probably damaging Het
Map3k21 T C 8: 125,942,119 S815P probably benign Het
Mast4 A G 13: 102,751,560 S1114P probably damaging Het
Myh8 C T 11: 67,303,765 Q1601* probably null Het
Nhlrc2 A G 19: 56,570,527 D148G probably damaging Het
Nos1 T A 5: 117,943,320 S1196T probably benign Het
Nsmaf C T 4: 6,424,874 probably null Het
Obscn T C 11: 58,999,623 D7361G unknown Het
Olfr1350 C T 7: 6,570,360 A123V probably damaging Het
Olfr600 C A 7: 103,346,878 A17S probably benign Het
Olfr721-ps1 T C 14: 14,407,777 V183A probably damaging Het
Pank3 T G 11: 35,777,709 M175R probably benign Het
Pcdhb21 G A 18: 37,514,513 D232N probably damaging Het
Pcdhb22 T C 18: 37,518,872 F131S probably damaging Het
Pik3r6 G A 11: 68,528,782 A140T possibly damaging Het
Pinlyp T C 7: 24,542,522 T87A possibly damaging Het
Pld1 T C 3: 28,124,575 S873P probably damaging Het
Pld5 T A 1: 176,274,729 Y49F probably benign Het
Polq T C 16: 37,034,890 V449A probably damaging Het
Prkca A G 11: 107,978,280 V69A probably benign Het
Ptk6 A G 2: 181,202,282 S75P possibly damaging Het
Ptprq G A 10: 107,582,530 Q1662* probably null Het
Ptprt C A 2: 161,553,822 A1144S probably damaging Het
Rrm1 T A 7: 102,466,926 W684R probably damaging Het
Ryr1 T A 7: 29,036,075 M4093L probably damaging Het
Scnn1a C T 6: 125,322,226 L90F probably damaging Het
Slc25a19 G T 11: 115,617,597 Y188* probably null Het
Slc31a1 C T 4: 62,385,629 probably benign Het
Slc5a11 C G 7: 123,265,235 S351R possibly damaging Het
Slc6a17 A G 3: 107,476,867 L387P probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spam1 T A 6: 24,797,838 L331Q probably damaging Het
Spata32 A G 11: 103,209,299 W127R probably damaging Het
Spta1 T G 1: 174,213,942 I1324S probably damaging Het
St6galnac4 A G 2: 32,594,318 Y176C probably damaging Het
Stk10 A G 11: 32,596,724 E327G probably damaging Het
Stxbp5l T A 16: 37,134,284 Y912F possibly damaging Het
Tchp G A 5: 114,720,182 E459K probably benign Het
Terf2 C T 8: 107,096,210 W100* probably null Het
Thrsp T C 7: 97,417,427 N26S probably damaging Het
Tln1 C A 4: 43,553,504 R297L probably benign Het
Tmeff2 C A 1: 50,928,075 T43N possibly damaging Het
Tmx1 C T 12: 70,453,173 A2V possibly damaging Het
Tnks1bp1 T A 2: 85,072,137 L1053Q probably damaging Het
Trmt10b A T 4: 45,304,286 K107N probably damaging Het
Trpa1 A T 1: 14,885,748 probably null Het
Trrap A G 5: 144,846,477 K3371R probably damaging Het
Tuba3b G A 6: 145,618,269 V14I probably benign Het
Usp19 T C 9: 108,494,240 probably null Het
Usp28 C A 9: 49,039,101 D615E possibly damaging Het
Utp20 T C 10: 88,822,069 D43G probably benign Het
Vmn1r58 T G 7: 5,410,998 K78Q possibly damaging Het
Vmn2r10 T C 5: 109,003,461 M96V probably benign Het
Wdr90 T C 17: 25,860,049 E273G probably damaging Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zscan21 T C 5: 138,133,603 I463T possibly damaging Het
Other mutations in Papolg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Papolg APN 11 23876377 missense possibly damaging 0.93
IGL01016:Papolg APN 11 23885570 missense possibly damaging 0.58
IGL01394:Papolg APN 11 23867235 missense probably benign
IGL01710:Papolg APN 11 23864026 missense probably damaging 0.99
IGL01786:Papolg APN 11 23874488 missense probably damaging 1.00
IGL02008:Papolg APN 11 23879898 missense probably damaging 1.00
IGL02127:Papolg APN 11 23870870 unclassified probably benign
IGL02329:Papolg APN 11 23891869 missense probably damaging 0.98
IGL02535:Papolg APN 11 23890245 missense probably benign 0.00
IGL02588:Papolg APN 11 23890252 missense probably damaging 1.00
IGL03058:Papolg APN 11 23895029 missense probably benign 0.00
IGL03301:Papolg APN 11 23874503 missense probably benign 0.05
Runningback UTSW 11 23873919 splice site probably null
R0124:Papolg UTSW 11 23867535 missense probably benign 0.21
R0369:Papolg UTSW 11 23872425 critical splice donor site probably null
R0743:Papolg UTSW 11 23870818 splice site probably null
R0931:Papolg UTSW 11 23882257 missense probably damaging 0.96
R1856:Papolg UTSW 11 23867379 missense probably benign 0.06
R1940:Papolg UTSW 11 23867279 missense probably benign 0.00
R2239:Papolg UTSW 11 23876378 missense probably damaging 0.99
R3802:Papolg UTSW 11 23876449 missense probably damaging 1.00
R4275:Papolg UTSW 11 23868378 missense probably benign
R4989:Papolg UTSW 11 23873919 splice site probably null
R5074:Papolg UTSW 11 23867331 missense possibly damaging 0.78
R5122:Papolg UTSW 11 23867501 critical splice donor site probably null
R6048:Papolg UTSW 11 23891815 missense probably benign 0.04
R6365:Papolg UTSW 11 23882290 missense probably damaging 1.00
R6577:Papolg UTSW 11 23879857 critical splice donor site probably benign
R7117:Papolg UTSW 11 23895207 start gained probably benign
R7283:Papolg UTSW 11 23867394 missense not run
R7372:Papolg UTSW 11 23866439 missense probably benign 0.16
R7761:Papolg UTSW 11 23891884 missense probably benign 0.05
R8503:Papolg UTSW 11 23870292 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acataggcacatacatacagagag -3'
Posted On2013-05-23