Mutagenetix > Incidental Mutations

Incidental Mutation 'R4275:Papolg'

324763

Institutional Source

Beutler Lab

Gene Symbol

Papolg

Ensembl Gene

ENSMUSG00000020273

Gene Name

poly(A) polymerase gamma

Synonyms

MMRRC Submission

041646-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.921) question?

Stock #

R4275 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23862646-23895253 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23868378 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 500 (I500T)

Ref Sequence

ENSEMBL: ENSMUSP00000020513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020513] [ENSMUST00000102863]

Predicted Effect

probably benign
Transcript: ENSMUST00000020513
AA Change: I500T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000020513
Gene: ENSMUSG00000020273
AA Change: I500T

Domain	Start	End	E-Value	Type
Pfam:PAP_central	20	363	1.4e-118	PFAM
Pfam:NTP_transf_2	53	174	2.8e-15	PFAM
Pfam:PAP_RNA-bind	365	431	2.4e-22	PFAM
Pfam:PAP_RNA-bind	421	506	1.2e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102863

SMART Domains

Protein: ENSMUSP00000099927
Gene: ENSMUSG00000020273

Domain	Start	End	E-Value	Type
Pfam:PAP_central	16	364	1.5e-111	PFAM
Pfam:NTP_transf_2	89	174	9.2e-12	PFAM
Pfam:PAP_RNA-bind	365	429	6.6e-25	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000145013
AA Change: I31T

SMART Domains

Protein: ENSMUSP00000115518
Gene: ENSMUSG00000020273
AA Change: I31T

Domain	Start	End	E-Value	Type
SCOP:d1f5aa1	2	29	3e-10	SMART
PDB:4LT6\|B	2	38	4e-16	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150711

Meta Mutation Damage Score

0.0743

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(A) polymerase family which catalyzes template-independent extension of the 3' end of a DNA/RNA strand. This enzyme shares 60% identity to the well characterized poly(A) polymerase II (PAPII) at the amino acid level. These two enzymes have similar organization of structural and functional domains. This enzyme is exclusively localized in the nucleus and exhibits both nonspecific and CPSF (cleavage and polyadenylation specificity factor)/AAUAAA-dependent polyadenylation activity. This gene is located on chromosome 2 in contrast to the PAPII gene, which is located on chromosome 14. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cacna1e	T	C	1: 154,493,325	Y322C	probably damaging	Het
Camsap2	A	G	1: 136,270,876	V1462A	probably benign	Het
D3Ertd751e	C	A	3: 41,756,154		probably benign	Het
Dhcr7	C	T	7: 143,843,227	A152V	probably damaging	Het
Enpep	A	T	3: 129,332,278	N68K	probably benign	Het
Fam126b	T	C	1: 58,529,933	T440A	probably benign	Het
Fam131b	G	A	6: 42,321,307	L43F	probably damaging	Het
Fbxl5	T	A	5: 43,762,772		probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Igf2	T	C	7: 142,655,786	M46V	probably benign	Het
Kntc1	T	A	5: 123,767,779	Y367N	probably damaging	Het
Mapk8ip2	T	C	15: 89,458,995	W647R	probably damaging	Het
Mettl21c	C	T	1: 44,010,556	V110I	probably damaging	Het
Mrgprh	T	C	17: 12,877,227	L118P	probably damaging	Het
Myadm	A	G	7: 3,297,102	T127A	probably benign	Het
Myh10	A	T	11: 68,751,940		probably null	Het
Nadk	T	A	4: 155,584,255	Y128N	probably benign	Het
Olfr1089	T	C	2: 86,733,592	T7A	probably damaging	Het
Olfr996	T	C	2: 85,579,863	V208A	probably benign	Het
Pkhd1	A	T	1: 20,058,384	C4032S	probably benign	Het
Rnase1	A	T	14: 51,145,870	L9Q	probably damaging	Het
Rspry1	G	T	8: 94,649,761	V304L	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Scpep1	T	C	11: 88,947,142		probably null	Het
Serpina3m	T	A	12: 104,389,116	I14N	probably damaging	Het
Smg6	A	C	11: 74,993,874		probably benign	Het
Suz12	T	C	11: 80,030,053	M593T	probably damaging	Het
Tmem139	A	G	6: 42,264,105	E208G	probably damaging	Het
Tnxb	A	G	17: 34,698,231	Y2200C	probably damaging	Het
Usp19	T	G	9: 108,498,694	V911G	probably damaging	Het
Vipr1	T	C	9: 121,664,618	L245P	probably damaging	Het
Vmn2r105	T	A	17: 20,228,640	I92F	probably damaging	Het
Zfp518b	A	G	5: 38,671,728	V978A	probably damaging	Het
Zfp651	T	A	9: 121,766,539	V576D	probably damaging	Het

Other mutations in Papolg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Papolg	APN	11	23876377	missense	possibly damaging	0.93
IGL01016:Papolg	APN	11	23885570	missense	possibly damaging	0.58
IGL01394:Papolg	APN	11	23867235	missense	probably benign
IGL01710:Papolg	APN	11	23864026	missense	probably damaging	0.99
IGL01786:Papolg	APN	11	23874488	missense	probably damaging	1.00
IGL02008:Papolg	APN	11	23879898	missense	probably damaging	1.00
IGL02127:Papolg	APN	11	23870870	unclassified	probably benign
IGL02329:Papolg	APN	11	23891869	missense	probably damaging	0.98
IGL02535:Papolg	APN	11	23890245	missense	probably benign	0.00
IGL02588:Papolg	APN	11	23890252	missense	probably damaging	1.00
IGL03058:Papolg	APN	11	23895029	missense	probably benign	0.00
IGL03301:Papolg	APN	11	23874503	missense	probably benign	0.05
R0124:Papolg	UTSW	11	23867535	missense	probably benign	0.21
R0369:Papolg	UTSW	11	23872425	critical splice donor site	probably null
R0454:Papolg	UTSW	11	23879868	splice site	probably null
R0743:Papolg	UTSW	11	23870818	unclassified	probably null
R0931:Papolg	UTSW	11	23882257	missense	probably damaging	0.96
R1856:Papolg	UTSW	11	23867379	missense	probably benign	0.06
R1940:Papolg	UTSW	11	23867279	missense	probably benign	0.00
R2239:Papolg	UTSW	11	23876378	missense	probably damaging	0.99
R3802:Papolg	UTSW	11	23876449	missense	probably damaging	1.00
R4989:Papolg	UTSW	11	23873919	splice site	probably null
R5074:Papolg	UTSW	11	23867331	missense	possibly damaging	0.78
R5122:Papolg	UTSW	11	23867501	critical splice donor site	probably null
R6048:Papolg	UTSW	11	23891815	missense	probably benign	0.04
R6365:Papolg	UTSW	11	23882290	missense	probably damaging	1.00
R6577:Papolg	UTSW	11	23879857	critical splice donor site	probably benign
R7117:Papolg	UTSW	11	23895207	start gained	probably benign
R7283:Papolg	UTSW	11	23867394	missense	not run
R7372:Papolg	UTSW	11	23866439	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- CAGAGACTACCTTCAGTTCCG -3'
(R):5'- AGAAATATCTGTTCCCACAAGAGGG -3'

Sequencing Primer
(F):5'- CCTCTTTCCAAACAGGGTTA -3'
(R):5'- GGGGCATAGAGGTTTATATATTTCAG -3'

Posted On

2015-06-24