Incidental Mutation 'R0454:Mast4'
ID39914
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Namemicrotubule associated serine/threonine kinase family member 4
Synonyms4930420O11Rik
MMRRC Submission 038654-MU
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Is this an essential gene? Possibly essential (E-score: 0.505) question?
Stock #R0454 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location102732486-103334497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102751560 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1114 (S1114P)
Ref Sequence ENSEMBL: ENSMUSP00000128464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000171791] [ENSMUST00000172264]
Predicted Effect probably damaging
Transcript: ENSMUST00000099202
AA Change: S937P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: S937P

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166726
AA Change: S1047P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751
AA Change: S1047P

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167058
AA Change: S1114P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: S1114P

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167462
AA Change: S855P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751
AA Change: S855P

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171791
AA Change: S922P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: S922P

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172264
SMART Domains Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 49 326 4.1e-147 PFAM
S_TKc 364 637 4.13e-98 SMART
S_TK_X 638 702 3.79e-2 SMART
low complexity region 718 731 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 813 830 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194446
AA Change: S946P
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik A G 5: 118,255,821 E88G possibly damaging Het
4930447F04Rik T C X: 66,303,668 E91G unknown Het
Acot1 A G 12: 84,017,339 Q407R probably benign Het
Adcy10 T A 1: 165,570,728 Y1465N probably damaging Het
Ahsa2 T A 11: 23,490,702 I249F probably damaging Het
Arhgap10 T C 8: 77,250,965 N721S probably damaging Het
Arrdc4 T G 7: 68,741,871 E216A probably damaging Het
Axin1 T C 17: 26,173,663 V306A probably benign Het
BC005561 T G 5: 104,518,211 S200A probably benign Het
Cct3 T C 3: 88,302,866 probably null Het
Cfap58 G A 19: 47,974,680 probably null Het
Chd9 T C 8: 90,973,231 S49P possibly damaging Het
Clcn2 C A 16: 20,710,428 probably null Het
Col26a1 T C 5: 136,754,193 N286D probably benign Het
Cpt1b T A 15: 89,424,393 I111F possibly damaging Het
Cyp4f16 T A 17: 32,537,087 I30N probably damaging Het
Ddc T G 11: 11,880,587 D19A possibly damaging Het
Depdc1a T A 3: 159,516,900 probably null Het
Evc2 T A 5: 37,417,484 C1028S possibly damaging Het
Fam228a T C 12: 4,731,457 E134G probably damaging Het
Fasl T C 1: 161,787,954 E111G probably benign Het
Fbxw10 A G 11: 62,876,738 N800S possibly damaging Het
Fras1 T C 5: 96,762,665 S3318P probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gad1 T A 2: 70,579,201 M212K probably damaging Het
Gm17455 T G 10: 60,402,973 S6A probably benign Het
Grm5 T C 7: 88,130,789 S1146P probably damaging Het
Gsn T C 2: 35,304,639 L649P probably damaging Het
H2-DMb1 A G 17: 34,155,711 T112A probably benign Het
Hcn3 T A 3: 89,152,894 I148F probably damaging Het
Hdac10 T C 15: 89,125,758 probably null Het
Hk3 C A 13: 55,008,705 D619Y probably damaging Het
Ifi44 T A 3: 151,745,497 R272S possibly damaging Het
Il1rap A C 16: 26,698,875 D275A probably damaging Het
Itgam A T 7: 128,107,980 N660I probably benign Het
Itpr3 T C 17: 27,113,819 M1853T probably benign Het
Lrmp A G 6: 145,167,984 R293G possibly damaging Het
Lrrc8c A C 5: 105,607,099 K247Q probably damaging Het
Map3k21 T C 8: 125,942,119 S815P probably benign Het
Myh8 C T 11: 67,303,765 Q1601* probably null Het
Nhlrc2 A G 19: 56,570,527 D148G probably damaging Het
Nos1 T A 5: 117,943,320 S1196T probably benign Het
Nsmaf C T 4: 6,424,874 probably null Het
Obscn T C 11: 58,999,623 D7361G unknown Het
Olfr1350 C T 7: 6,570,360 A123V probably damaging Het
Olfr600 C A 7: 103,346,878 A17S probably benign Het
Olfr721-ps1 T C 14: 14,407,777 V183A probably damaging Het
Pank3 T G 11: 35,777,709 M175R probably benign Het
Papolg A G 11: 23,879,868 probably null Het
Pcdhb21 G A 18: 37,514,513 D232N probably damaging Het
Pcdhb22 T C 18: 37,518,872 F131S probably damaging Het
Pik3r6 G A 11: 68,528,782 A140T possibly damaging Het
Pinlyp T C 7: 24,542,522 T87A possibly damaging Het
Pld1 T C 3: 28,124,575 S873P probably damaging Het
Pld5 T A 1: 176,274,729 Y49F probably benign Het
Polq T C 16: 37,034,890 V449A probably damaging Het
Prkca A G 11: 107,978,280 V69A probably benign Het
Ptk6 A G 2: 181,202,282 S75P possibly damaging Het
Ptprq G A 10: 107,582,530 Q1662* probably null Het
Ptprt C A 2: 161,553,822 A1144S probably damaging Het
Rrm1 T A 7: 102,466,926 W684R probably damaging Het
Ryr1 T A 7: 29,036,075 M4093L probably damaging Het
Scnn1a C T 6: 125,322,226 L90F probably damaging Het
Slc25a19 G T 11: 115,617,597 Y188* probably null Het
Slc31a1 C T 4: 62,385,629 probably benign Het
Slc5a11 C G 7: 123,265,235 S351R possibly damaging Het
Slc6a17 A G 3: 107,476,867 L387P probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spam1 T A 6: 24,797,838 L331Q probably damaging Het
Spata32 A G 11: 103,209,299 W127R probably damaging Het
Spta1 T G 1: 174,213,942 I1324S probably damaging Het
St6galnac4 A G 2: 32,594,318 Y176C probably damaging Het
Stk10 A G 11: 32,596,724 E327G probably damaging Het
Stxbp5l T A 16: 37,134,284 Y912F possibly damaging Het
Tchp G A 5: 114,720,182 E459K probably benign Het
Terf2 C T 8: 107,096,210 W100* probably null Het
Thrsp T C 7: 97,417,427 N26S probably damaging Het
Tln1 C A 4: 43,553,504 R297L probably benign Het
Tmeff2 C A 1: 50,928,075 T43N possibly damaging Het
Tmx1 C T 12: 70,453,173 A2V possibly damaging Het
Tnks1bp1 T A 2: 85,072,137 L1053Q probably damaging Het
Trmt10b A T 4: 45,304,286 K107N probably damaging Het
Trpa1 A T 1: 14,885,748 probably null Het
Trrap A G 5: 144,846,477 K3371R probably damaging Het
Tuba3b G A 6: 145,618,269 V14I probably benign Het
Usp19 T C 9: 108,494,240 probably null Het
Usp28 C A 9: 49,039,101 D615E possibly damaging Het
Utp20 T C 10: 88,822,069 D43G probably benign Het
Vmn1r58 T G 7: 5,410,998 K78Q possibly damaging Het
Vmn2r10 T C 5: 109,003,461 M96V probably benign Het
Wdr90 T C 17: 25,860,049 E273G probably damaging Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zscan21 T C 5: 138,133,603 I463T possibly damaging Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102734857 frame shift probably null
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102735273 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0883:Mast4 UTSW 13 102853900 missense probably damaging 1.00
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R1865:Mast4 UTSW 13 102794117 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2106:Mast4 UTSW 13 102750546 missense probably damaging 1.00
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2504:Mast4 UTSW 13 102738639 missense probably damaging 0.96
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3434:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5073:Mast4 UTSW 13 102738883 nonsense probably null
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5908:Mast4 UTSW 13 102738256 missense probably damaging 1.00
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6980:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6991:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6992:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6993:Mast4 UTSW 13 102735974 missense probably benign 0.28
R6993:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R7083:Mast4 UTSW 13 102737715 missense probably damaging 1.00
R7241:Mast4 UTSW 13 103334000 missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102738478 missense probably damaging 1.00
R7246:Mast4 UTSW 13 102794003 missense probably damaging 1.00
R7332:Mast4 UTSW 13 102751424 missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102804641 critical splice donor site probably null
R7514:Mast4 UTSW 13 102787426 nonsense probably null
R7697:Mast4 UTSW 13 102739203 missense probably damaging 1.00
R7820:Mast4 UTSW 13 102754088 missense probably damaging 1.00
R7874:Mast4 UTSW 13 102739275 missense probably damaging 1.00
R7957:Mast4 UTSW 13 102739275 missense probably damaging 1.00
R8042:Mast4 UTSW 13 102781245 missense probably damaging 0.96
R8060:Mast4 UTSW 13 102737676 missense possibly damaging 0.89
RF005:Mast4 UTSW 13 102736307 small insertion probably benign
RF015:Mast4 UTSW 13 102739247 frame shift probably null
RF019:Mast4 UTSW 13 102736307 small insertion probably benign
RF037:Mast4 UTSW 13 102739241 small deletion probably benign
RF039:Mast4 UTSW 13 102739241 small deletion probably benign
RF040:Mast4 UTSW 13 102739241 small deletion probably benign
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102738460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGTGTAGATGTCACTGTCCC -3'
(R):5'- GCATTCTTCTGTGAAGAGGAGCAGC -3'

Sequencing Primer
(F):5'- CCCACGTACACGCGGATAG -3'
(R):5'- GAGTTTGGCATCCATACAGGTTAC -3'
Posted On2013-05-23