Mutagenetix > Incidental Mutations

Incidental Mutation 'R0454:Mast4'

39914

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

038654-MU

Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791, ENSMUST00000091273

Is this an essential gene?

Possibly essential (E-score: 0.505) question?

Stock #

R0454 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102732486-103334497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102751560 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1114 (S1114P)

Ref Sequence

ENSEMBL: ENSMUSP00000128464 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000171791] [ENSMUST00000172264]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099202
AA Change: S937P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: S937P

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166726
AA Change: S1047P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751
AA Change: S1047P

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167058
AA Change: S1114P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: S1114P

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167462
AA Change: S855P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751
AA Change: S855P

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	3e-145	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	843	878	N/A	INTRINSIC
PDZ	888	968	2.34e-15	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171791
AA Change: S922P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: S922P

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	1.2e-144	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	825	842	N/A	INTRINSIC
low complexity region	910	945	N/A	INTRINSIC
PDZ	955	1035	2.34e-15	SMART
low complexity region	1055	1072	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1127	1149	N/A	INTRINSIC
low complexity region	1187	1204	N/A	INTRINSIC
low complexity region	1275	1291	N/A	INTRINSIC
low complexity region	1330	1346	N/A	INTRINSIC
low complexity region	1922	1938	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2135	2146	N/A	INTRINSIC
low complexity region	2281	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172264

SMART Domains

Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
Pfam:DUF1908	49	326	4.1e-147	PFAM
S_TKc	364	637	4.13e-98	SMART
S_TK_X	638	702	3.79e-2	SMART
low complexity region	718	731	N/A	INTRINSIC
low complexity region	791	804	N/A	INTRINSIC
low complexity region	813	830	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000194446
AA Change: S946P

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	A	G	5: 118,255,821	E88G	possibly damaging	Het
4930447F04Rik	T	C	X: 66,303,668	E91G	unknown	Het
Acot1	A	G	12: 84,017,339	Q407R	probably benign	Het
Adcy10	T	A	1: 165,570,728	Y1465N	probably damaging	Het
Ahsa2	T	A	11: 23,490,702	I249F	probably damaging	Het
Arhgap10	T	C	8: 77,250,965	N721S	probably damaging	Het
Arrdc4	T	G	7: 68,741,871	E216A	probably damaging	Het
Axin1	T	C	17: 26,173,663	V306A	probably benign	Het
BC005561	T	G	5: 104,518,211	S200A	probably benign	Het
Cct3	T	C	3: 88,302,866		probably null	Het
Cfap58	G	A	19: 47,974,680		probably null	Het
Chd9	T	C	8: 90,973,231	S49P	possibly damaging	Het
Clcn2	C	A	16: 20,710,428		probably null	Het
Col26a1	T	C	5: 136,754,193	N286D	probably benign	Het
Cpt1b	T	A	15: 89,424,393	I111F	possibly damaging	Het
Cyp4f16	T	A	17: 32,537,087	I30N	probably damaging	Het
Ddc	T	G	11: 11,880,587	D19A	possibly damaging	Het
Depdc1a	T	A	3: 159,516,900		probably null	Het
Evc2	T	A	5: 37,417,484	C1028S	possibly damaging	Het
Fam228a	T	C	12: 4,731,457	E134G	probably damaging	Het
Fasl	T	C	1: 161,787,954	E111G	probably benign	Het
Fbxw10	A	G	11: 62,876,738	N800S	possibly damaging	Het
Fras1	T	C	5: 96,762,665	S3318P	probably damaging	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gad1	T	A	2: 70,579,201	M212K	probably damaging	Het
Gm17455	T	G	10: 60,402,973	S6A	probably benign	Het
Grm5	T	C	7: 88,130,789	S1146P	probably damaging	Het
Gsn	T	C	2: 35,304,639	L649P	probably damaging	Het
H2-DMb1	A	G	17: 34,155,711	T112A	probably benign	Het
Hcn3	T	A	3: 89,152,894	I148F	probably damaging	Het
Hdac10	T	C	15: 89,125,758		probably null	Het
Hk3	C	A	13: 55,008,705	D619Y	probably damaging	Het
Ifi44	T	A	3: 151,745,497	R272S	possibly damaging	Het
Il1rap	A	C	16: 26,698,875	D275A	probably damaging	Het
Itgam	A	T	7: 128,107,980	N660I	probably benign	Het
Itpr3	T	C	17: 27,113,819	M1853T	probably benign	Het
Lrmp	A	G	6: 145,167,984	R293G	possibly damaging	Het
Lrrc8c	A	C	5: 105,607,099	K247Q	probably damaging	Het
Map3k21	T	C	8: 125,942,119	S815P	probably benign	Het
Myh8	C	T	11: 67,303,765	Q1601*	probably null	Het
Nhlrc2	A	G	19: 56,570,527	D148G	probably damaging	Het
Nos1	T	A	5: 117,943,320	S1196T	probably benign	Het
Nsmaf	C	T	4: 6,424,874		probably null	Het
Obscn	T	C	11: 58,999,623	D7361G	unknown	Het
Olfr1350	C	T	7: 6,570,360	A123V	probably damaging	Het
Olfr600	C	A	7: 103,346,878	A17S	probably benign	Het
Olfr721-ps1	T	C	14: 14,407,777	V183A	probably damaging	Het
Pank3	T	G	11: 35,777,709	M175R	probably benign	Het
Papolg	A	G	11: 23,879,868		probably null	Het
Pcdhb21	G	A	18: 37,514,513	D232N	probably damaging	Het
Pcdhb22	T	C	18: 37,518,872	F131S	probably damaging	Het
Pik3r6	G	A	11: 68,528,782	A140T	possibly damaging	Het
Pinlyp	T	C	7: 24,542,522	T87A	possibly damaging	Het
Pld1	T	C	3: 28,124,575	S873P	probably damaging	Het
Pld5	T	A	1: 176,274,729	Y49F	probably benign	Het
Polq	T	C	16: 37,034,890	V449A	probably damaging	Het
Prkca	A	G	11: 107,978,280	V69A	probably benign	Het
Ptk6	A	G	2: 181,202,282	S75P	possibly damaging	Het
Ptprq	G	A	10: 107,582,530	Q1662*	probably null	Het
Ptprt	C	A	2: 161,553,822	A1144S	probably damaging	Het
Rrm1	T	A	7: 102,466,926	W684R	probably damaging	Het
Ryr1	T	A	7: 29,036,075	M4093L	probably damaging	Het
Scnn1a	C	T	6: 125,322,226	L90F	probably damaging	Het
Slc25a19	G	T	11: 115,617,597	Y188*	probably null	Het
Slc31a1	C	T	4: 62,385,629		probably benign	Het
Slc5a11	C	G	7: 123,265,235	S351R	possibly damaging	Het
Slc6a17	A	G	3: 107,476,867	L387P	probably benign	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Spam1	T	A	6: 24,797,838	L331Q	probably damaging	Het
Spata32	A	G	11: 103,209,299	W127R	probably damaging	Het
Spta1	T	G	1: 174,213,942	I1324S	probably damaging	Het
St6galnac4	A	G	2: 32,594,318	Y176C	probably damaging	Het
Stk10	A	G	11: 32,596,724	E327G	probably damaging	Het
Stxbp5l	T	A	16: 37,134,284	Y912F	possibly damaging	Het
Tchp	G	A	5: 114,720,182	E459K	probably benign	Het
Terf2	C	T	8: 107,096,210	W100*	probably null	Het
Thrsp	T	C	7: 97,417,427	N26S	probably damaging	Het
Tln1	C	A	4: 43,553,504	R297L	probably benign	Het
Tmeff2	C	A	1: 50,928,075	T43N	possibly damaging	Het
Tmx1	C	T	12: 70,453,173	A2V	possibly damaging	Het
Tnks1bp1	T	A	2: 85,072,137	L1053Q	probably damaging	Het
Trmt10b	A	T	4: 45,304,286	K107N	probably damaging	Het
Trpa1	A	T	1: 14,885,748		probably null	Het
Trrap	A	G	5: 144,846,477	K3371R	probably damaging	Het
Tuba3b	G	A	6: 145,618,269	V14I	probably benign	Het
Usp19	T	C	9: 108,494,240		probably null	Het
Usp28	C	A	9: 49,039,101	D615E	possibly damaging	Het
Utp20	T	C	10: 88,822,069	D43G	probably benign	Het
Vmn1r58	T	G	7: 5,410,998	K78Q	possibly damaging	Het
Vmn2r10	T	C	5: 109,003,461	M96V	probably benign	Het
Wdr90	T	C	17: 25,860,049	E273G	probably damaging	Het
Xpc	C	T	6: 91,491,226	A860T	probably benign	Het
Zscan21	T	C	5: 138,133,603	I463T	possibly damaging	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102770767	nonsense	probably null
IGL00933:Mast4	APN	13	102735366	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102774236	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102754068	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102761015	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102767893	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102750512	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102737615	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102737241	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102774273	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102737974	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102742037	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102735496	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102853823	makesense	probably null
IGL02850:Mast4	APN	13	102754232	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102735676	missense	probably benign
IGL03064:Mast4	APN	13	102760964	nonsense	probably null
IGL03124:Mast4	APN	13	102738245	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102737655	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102754256	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102751397	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102737107	missense	possibly damaging	0.46
buck	UTSW	13	102761293	critical splice donor site	probably null
doe	UTSW	13	102905677	missense	possibly damaging	0.85
FR4304:Mast4	UTSW	13	102734862	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102734857	frame shift	probably null
FR4340:Mast4	UTSW	13	102736317	small insertion	probably benign
FR4548:Mast4	UTSW	13	102736318	small insertion	probably benign
FR4976:Mast4	UTSW	13	102736312	small insertion	probably benign
FR4976:Mast4	UTSW	13	102739247	frame shift	probably null
NA:Mast4	UTSW	13	102742057	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102742058	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103334215	start gained	probably benign
R0242:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102754161	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102735273	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102758744	splice site	probably benign
R0744:Mast4	UTSW	13	102737387	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102853900	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102770784	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102735496	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102750578	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102772519	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102736923	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102739263	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102794117	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102751409	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102738846	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102759093	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102750546	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102754205	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102735475	missense	possibly damaging	0.89
R2256:Mast4	UTSW	13	102735751	missense	possibly damaging	0.62
R2261:Mast4	UTSW	13	102798207	splice site	probably benign
R2370:Mast4	UTSW	13	102774187	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102738639	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102736431	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102853926	splice site	probably benign
R3434:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102787419	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102739321	nonsense	probably null
R4021:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102853869	missense	probably damaging	1.00
R4210:Mast4	UTSW	13	102739205	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102774248	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102737258	nonsense	probably null
R4627:Mast4	UTSW	13	103334021	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103334119	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102774184	critical splice donor site	probably null
R4995:Mast4	UTSW	13	102905754	intron	probably benign
R5059:Mast4	UTSW	13	102750563	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102738883	nonsense	probably null
R5101:Mast4	UTSW	13	102736356	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102754215	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102737479	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102794072	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102774193	nonsense	probably null
R5906:Mast4	UTSW	13	102735744	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102738256	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102735640	missense	probably benign
R5987:Mast4	UTSW	13	102758734	missense	probably damaging	1.00
R6143:Mast4	UTSW	13	102853883	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102736209	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102761382	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102735985	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	102905677	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102761293	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102737496	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102804714	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102798078	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102735974	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102737715	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103334000	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102738478	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102794003	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102751424	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102804641	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102787426	nonsense	probably null
R7697:Mast4	UTSW	13	102739203	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102754088	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R7957:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R8042:Mast4	UTSW	13	102781245	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102737676	missense	possibly damaging	0.89
RF005:Mast4	UTSW	13	102736307	small insertion	probably benign
RF015:Mast4	UTSW	13	102739247	frame shift	probably null
RF019:Mast4	UTSW	13	102736307	small insertion	probably benign
RF037:Mast4	UTSW	13	102739241	small deletion	probably benign
RF039:Mast4	UTSW	13	102739241	small deletion	probably benign
RF040:Mast4	UTSW	13	102739241	small deletion	probably benign
Z1088:Mast4	UTSW	13	102738519	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102738460	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACTGTGTAGATGTCACTGTCCC -3'
(R):5'- GCATTCTTCTGTGAAGAGGAGCAGC -3'

Sequencing Primer
(F):5'- CCCACGTACACGCGGATAG -3'
(R):5'- GAGTTTGGCATCCATACAGGTTAC -3'

Posted On

2013-05-23