Mutagenetix > Incidental Mutation

Incidental Mutation 'R0454:Tln1'

39849

Institutional Source

Beutler Lab

Gene Symbol

Tln1

Ensembl Gene

ENSMUSG00000028465

Gene Name

talin 1

Synonyms

MMRRC Submission

038654-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0454 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43531519-43562691 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 43553504 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 297 (R297L)

Ref Sequence

ENSEMBL: ENSMUSP00000030187 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030187] [ENSMUST00000130353]

AlphaFold

P26039

PDB Structure

Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<

Predicted Effect

probably benign
Transcript: ENSMUST00000030187
AA Change: R297L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: R297L

Domain	Start	End	E-Value	Type
Blast:B41	2	76	5e-31	BLAST
B41	82	313	4.66e-73	SMART
IRS	308	401	7.65e-16	SMART
Pfam:Talin_middle	491	652	8.2e-60	PFAM
low complexity region	671	690	N/A	INTRINSIC
internal_repeat_2	699	760	8.94e-6	PROSPERO
low complexity region	766	775	N/A	INTRINSIC
PDB:1ZVZ\|B	820	844	2e-7	PDB
low complexity region	866	879	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
PDB:2LQG\|A	913	1044	2e-44	PDB
PDB:2L7N\|A	1046	1207	1e-101	PDB
Pfam:VBS	1234	1358	9.6e-8	PFAM
internal_repeat_2	1488	1549	8.94e-6	PROSPERO
internal_repeat_3	1623	1769	4.92e-5	PROSPERO
low complexity region	1817	1828	N/A	INTRINSIC
Pfam:VBS	1849	1973	6.2e-67	PFAM
PDB:3DYJ\|B	1974	2293	N/A	PDB
low complexity region	2305	2327	N/A	INTRINSIC
ILWEQ	2336	2533	2.93e-105	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125509

SMART Domains

Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

Domain	Start	End	E-Value	Type
Blast:IRS	2	28	2e-9	BLAST
PDB:2G35\|A	2	29	3e-11	PDB
Pfam:Talin_middle	32	193	1.8e-61	PFAM
PDB:2L7A\|A	215	279	1e-38	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126078

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127262

Predicted Effect

probably benign
Transcript: ENSMUST00000130353

SMART Domains

Protein: ENSMUSP00000119441
Gene: ENSMUSG00000028465

Domain	Start	End	E-Value	Type
Blast:B41	1	39	9e-7	BLAST
B41	82	241	6.58e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130670

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	A	G	5: 118,255,821	E88G	possibly damaging	Het
4930447F04Rik	T	C	X: 66,303,668	E91G	unknown	Het
Acot1	A	G	12: 84,017,339	Q407R	probably benign	Het
Adcy10	T	A	1: 165,570,728	Y1465N	probably damaging	Het
Ahsa2	T	A	11: 23,490,702	I249F	probably damaging	Het
Arhgap10	T	C	8: 77,250,965	N721S	probably damaging	Het
Arrdc4	T	G	7: 68,741,871	E216A	probably damaging	Het
Axin1	T	C	17: 26,173,663	V306A	probably benign	Het
BC005561	T	G	5: 104,518,211	S200A	probably benign	Het
Cct3	T	C	3: 88,302,866		probably null	Het
Cfap58	G	A	19: 47,974,680		probably null	Het
Chd9	T	C	8: 90,973,231	S49P	possibly damaging	Het
Clcn2	C	A	16: 20,710,428		probably null	Het
Col26a1	T	C	5: 136,754,193	N286D	probably benign	Het
Cpt1b	T	A	15: 89,424,393	I111F	possibly damaging	Het
Cyp4f16	T	A	17: 32,537,087	I30N	probably damaging	Het
Ddc	T	G	11: 11,880,587	D19A	possibly damaging	Het
Depdc1a	T	A	3: 159,516,900		probably null	Het
Evc2	T	A	5: 37,417,484	C1028S	possibly damaging	Het
Fam228a	T	C	12: 4,731,457	E134G	probably damaging	Het
Fasl	T	C	1: 161,787,954	E111G	probably benign	Het
Fbxw10	A	G	11: 62,876,738	N800S	possibly damaging	Het
Fras1	T	C	5: 96,762,665	S3318P	probably damaging	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gad1	T	A	2: 70,579,201	M212K	probably damaging	Het
Gm17455	T	G	10: 60,402,973	S6A	probably benign	Het
Grm5	T	C	7: 88,130,789	S1146P	probably damaging	Het
Gsn	T	C	2: 35,304,639	L649P	probably damaging	Het
H2-DMb1	A	G	17: 34,155,711	T112A	probably benign	Het
Hcn3	T	A	3: 89,152,894	I148F	probably damaging	Het
Hdac10	T	C	15: 89,125,758		probably null	Het
Hk3	C	A	13: 55,008,705	D619Y	probably damaging	Het
Ifi44	T	A	3: 151,745,497	R272S	possibly damaging	Het
Il1rap	A	C	16: 26,698,875	D275A	probably damaging	Het
Itgam	A	T	7: 128,107,980	N660I	probably benign	Het
Itpr3	T	C	17: 27,113,819	M1853T	probably benign	Het
Lrmp	A	G	6: 145,167,984	R293G	possibly damaging	Het
Lrrc8c	A	C	5: 105,607,099	K247Q	probably damaging	Het
Map3k21	T	C	8: 125,942,119	S815P	probably benign	Het
Mast4	A	G	13: 102,751,560	S1114P	probably damaging	Het
Myh8	C	T	11: 67,303,765	Q1601*	probably null	Het
Nhlrc2	A	G	19: 56,570,527	D148G	probably damaging	Het
Nos1	T	A	5: 117,943,320	S1196T	probably benign	Het
Nsmaf	C	T	4: 6,424,874		probably null	Het
Obscn	T	C	11: 58,999,623	D7361G	unknown	Het
Olfr1350	C	T	7: 6,570,360	A123V	probably damaging	Het
Olfr600	C	A	7: 103,346,878	A17S	probably benign	Het
Olfr721-ps1	T	C	14: 14,407,777	V183A	probably damaging	Het
Pank3	T	G	11: 35,777,709	M175R	probably benign	Het
Papolg	A	G	11: 23,879,868		probably null	Het
Pcdhb21	G	A	18: 37,514,513	D232N	probably damaging	Het
Pcdhb22	T	C	18: 37,518,872	F131S	probably damaging	Het
Pik3r6	G	A	11: 68,528,782	A140T	possibly damaging	Het
Pinlyp	T	C	7: 24,542,522	T87A	possibly damaging	Het
Pld1	T	C	3: 28,124,575	S873P	probably damaging	Het
Pld5	T	A	1: 176,274,729	Y49F	probably benign	Het
Polq	T	C	16: 37,034,890	V449A	probably damaging	Het
Prkca	A	G	11: 107,978,280	V69A	probably benign	Het
Ptk6	A	G	2: 181,202,282	S75P	possibly damaging	Het
Ptprq	G	A	10: 107,582,530	Q1662*	probably null	Het
Ptprt	C	A	2: 161,553,822	A1144S	probably damaging	Het
Rrm1	T	A	7: 102,466,926	W684R	probably damaging	Het
Ryr1	T	A	7: 29,036,075	M4093L	probably damaging	Het
Scnn1a	C	T	6: 125,322,226	L90F	probably damaging	Het
Slc25a19	G	T	11: 115,617,597	Y188*	probably null	Het
Slc31a1	C	T	4: 62,385,629		probably benign	Het
Slc5a11	C	G	7: 123,265,235	S351R	possibly damaging	Het
Slc6a17	A	G	3: 107,476,867	L387P	probably benign	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Spam1	T	A	6: 24,797,838	L331Q	probably damaging	Het
Spata32	A	G	11: 103,209,299	W127R	probably damaging	Het
Spta1	T	G	1: 174,213,942	I1324S	probably damaging	Het
St6galnac4	A	G	2: 32,594,318	Y176C	probably damaging	Het
Stk10	A	G	11: 32,596,724	E327G	probably damaging	Het
Stxbp5l	T	A	16: 37,134,284	Y912F	possibly damaging	Het
Tchp	G	A	5: 114,720,182	E459K	probably benign	Het
Terf2	C	T	8: 107,096,210	W100*	probably null	Het
Thrsp	T	C	7: 97,417,427	N26S	probably damaging	Het
Tmeff2	C	A	1: 50,928,075	T43N	possibly damaging	Het
Tmx1	C	T	12: 70,453,173	A2V	possibly damaging	Het
Tnks1bp1	T	A	2: 85,072,137	L1053Q	probably damaging	Het
Trmt10b	A	T	4: 45,304,286	K107N	probably damaging	Het
Trpa1	A	T	1: 14,885,748		probably null	Het
Trrap	A	G	5: 144,846,477	K3371R	probably damaging	Het
Tuba3b	G	A	6: 145,618,269	V14I	probably benign	Het
Usp19	T	C	9: 108,494,240		probably null	Het
Usp28	C	A	9: 49,039,101	D615E	possibly damaging	Het
Utp20	T	C	10: 88,822,069	D43G	probably benign	Het
Vmn1r58	T	G	7: 5,410,998	K78Q	possibly damaging	Het
Vmn2r10	T	C	5: 109,003,461	M96V	probably benign	Het
Wdr90	T	C	17: 25,860,049	E273G	probably damaging	Het
Xpc	C	T	6: 91,491,226	A860T	probably benign	Het
Zscan21	T	C	5: 138,133,603	I463T	possibly damaging	Het

Other mutations in Tln1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Tln1	APN	4	43542719	missense	probably benign	0.22
IGL00987:Tln1	APN	4	43551297	unclassified	probably benign
IGL01345:Tln1	APN	4	43536281	missense	probably damaging	1.00
IGL01456:Tln1	APN	4	43543432	unclassified	probably benign
IGL01715:Tln1	APN	4	43555890	missense	probably damaging	1.00
IGL01750:Tln1	APN	4	43545435	missense	probably damaging	1.00
IGL01933:Tln1	APN	4	43539508	missense	probably benign
IGL01933:Tln1	APN	4	43555894	missense	possibly damaging	0.52
IGL02119:Tln1	APN	4	43546760	missense	probably damaging	0.99
IGL02148:Tln1	APN	4	43555388	missense	probably damaging	1.00
IGL02153:Tln1	APN	4	43546857	missense	possibly damaging	0.76
IGL02522:Tln1	APN	4	43540612	missense	probably benign	0.07
IGL02691:Tln1	APN	4	43539544	missense	probably benign	0.42
IGL02882:Tln1	APN	4	43539522	missense	probably benign	0.45
IGL02892:Tln1	APN	4	43555679	missense	probably damaging	1.00
IGL03061:Tln1	APN	4	43545694	missense	probably damaging	1.00
IGL03102:Tln1	APN	4	43532861	missense	possibly damaging	0.89
IGL03183:Tln1	APN	4	43539084	splice site	probably benign
H8786:Tln1	UTSW	4	43544589	missense	probably damaging	0.97
PIT4576001:Tln1	UTSW	4	43539998	missense	probably damaging	1.00
PIT4696001:Tln1	UTSW	4	43542701	critical splice donor site	probably null
R0206:Tln1	UTSW	4	43549151	missense	probably damaging	1.00
R0208:Tln1	UTSW	4	43549151	missense	probably damaging	1.00
R0539:Tln1	UTSW	4	43543434	critical splice donor site	probably null
R0548:Tln1	UTSW	4	43542709	missense	possibly damaging	0.79
R0561:Tln1	UTSW	4	43550304	missense	possibly damaging	0.94
R0606:Tln1	UTSW	4	43547756	missense	probably benign	0.34
R0607:Tln1	UTSW	4	43553071	missense	probably damaging	1.00
R0609:Tln1	UTSW	4	43544645	missense	possibly damaging	0.63
R0847:Tln1	UTSW	4	43555333	missense	probably damaging	1.00
R0993:Tln1	UTSW	4	43549825	missense	probably benign	0.22
R1255:Tln1	UTSW	4	43538044	missense	probably damaging	1.00
R1292:Tln1	UTSW	4	43534578	critical splice donor site	probably null
R1752:Tln1	UTSW	4	43536311	missense	probably damaging	1.00
R2169:Tln1	UTSW	4	43548005	missense	probably damaging	1.00
R2172:Tln1	UTSW	4	43545721	missense	probably benign
R2202:Tln1	UTSW	4	43553083	splice site	probably null
R2680:Tln1	UTSW	4	43539668	missense	probably damaging	1.00
R3012:Tln1	UTSW	4	43542525	missense	probably benign
R3714:Tln1	UTSW	4	43540597	missense	probably damaging	1.00
R3735:Tln1	UTSW	4	43549370	missense	probably damaging	0.97
R3794:Tln1	UTSW	4	43536295	missense	probably damaging	1.00
R3825:Tln1	UTSW	4	43536413	splice site	probably benign
R3983:Tln1	UTSW	4	43553030	missense	probably damaging	1.00
R4061:Tln1	UTSW	4	43549177	missense	probably damaging	1.00
R4249:Tln1	UTSW	4	43536104	missense	probably damaging	1.00
R4287:Tln1	UTSW	4	43543509	missense	probably benign	0.01
R4471:Tln1	UTSW	4	43551018	missense	probably benign	0.03
R4562:Tln1	UTSW	4	43533598	missense	probably damaging	1.00
R4654:Tln1	UTSW	4	43535954	missense	probably null	1.00
R4737:Tln1	UTSW	4	43540588	missense	probably benign	0.00
R4936:Tln1	UTSW	4	43547522	missense	possibly damaging	0.83
R5225:Tln1	UTSW	4	43539406	missense	probably benign	0.06
R5288:Tln1	UTSW	4	43540661	missense	probably benign	0.06
R5421:Tln1	UTSW	4	43533609	missense	possibly damaging	0.80
R5445:Tln1	UTSW	4	43543905	missense	probably benign	0.26
R5660:Tln1	UTSW	4	43547732	missense	probably damaging	1.00
R5772:Tln1	UTSW	4	43545191	missense	probably benign	0.13
R6012:Tln1	UTSW	4	43539508	missense	probably benign
R6038:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6038:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6039:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6039:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6052:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6145:Tln1	UTSW	4	43538030	missense	possibly damaging	0.64
R6157:Tln1	UTSW	4	43534744	missense	probably benign	0.06
R6242:Tln1	UTSW	4	43533145	missense	probably damaging	1.00
R6454:Tln1	UTSW	4	43533866	missense	probably damaging	0.99
R6467:Tln1	UTSW	4	43543165	missense	probably benign	0.42
R6548:Tln1	UTSW	4	43547525	missense	probably damaging	0.98
R6576:Tln1	UTSW	4	43555419	splice site	probably null
R6722:Tln1	UTSW	4	43547618	missense	probably damaging	1.00
R6968:Tln1	UTSW	4	43550217	missense	probably benign	0.02
R7000:Tln1	UTSW	4	43556302	missense	probably damaging	0.96
R7137:Tln1	UTSW	4	43540616	missense	probably damaging	1.00
R7242:Tln1	UTSW	4	43542602	missense	probably benign	0.01
R7294:Tln1	UTSW	4	43534399	missense	probably benign	0.02
R7312:Tln1	UTSW	4	43545922	missense	probably damaging	1.00
R7547:Tln1	UTSW	4	43545206	missense	possibly damaging	0.80
R7836:Tln1	UTSW	4	43554309	missense	probably benign	0.01
R7874:Tln1	UTSW	4	43538041	missense	probably damaging	1.00
R7874:Tln1	UTSW	4	43555606	missense	probably damaging	1.00
R8030:Tln1	UTSW	4	43535737	critical splice donor site	probably null
R8105:Tln1	UTSW	4	43538231	missense	probably benign	0.32
R8212:Tln1	UTSW	4	43555918	missense	probably damaging	1.00
R8416:Tln1	UTSW	4	43540116	missense	probably benign	0.01
R8419:Tln1	UTSW	4	43536397	missense	probably damaging	1.00
R8680:Tln1	UTSW	4	43553041	missense	possibly damaging	0.52
R8708:Tln1	UTSW	4	43534769	splice site	probably benign
R8725:Tln1	UTSW	4	43555911	missense	possibly damaging	0.94
R8727:Tln1	UTSW	4	43555911	missense	possibly damaging	0.94
R8830:Tln1	UTSW	4	43556383	missense	probably benign
R8865:Tln1	UTSW	4	43538281	missense	possibly damaging	0.93
R9049:Tln1	UTSW	4	43549786	nonsense	probably null
R9050:Tln1	UTSW	4	43549786	nonsense	probably null
R9145:Tln1	UTSW	4	43536024	missense	probably damaging	1.00
R9210:Tln1	UTSW	4	43536119	missense	probably damaging	1.00
R9337:Tln1	UTSW	4	43532927	missense	probably damaging	1.00
R9346:Tln1	UTSW	4	43546895	missense	probably damaging	0.97
R9358:Tln1	UTSW	4	43532084	missense	possibly damaging	0.68
R9487:Tln1	UTSW	4	43542893	missense	probably damaging	1.00
RF021:Tln1	UTSW	4	43555890	missense	probably damaging	1.00
X0052:Tln1	UTSW	4	43533125	critical splice donor site	probably null
X0063:Tln1	UTSW	4	43548015	nonsense	probably null
Z1176:Tln1	UTSW	4	43543211	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- TCCTTAGTGATGCCCAACAGCCTG -3'
(R):5'- TTTTGAACTCTGATGGCCCTGGAC -3'

Sequencing Primer
(F):5'- ACTGTGCTCACAGATAGGC -3'
(R):5'- TGCAGAGCATCTGCGAG -3'

Posted On

2013-05-23