Incidental Mutation 'R5253:Adcy7'
ID399224
Institutional Source Beutler Lab
Gene Symbol Adcy7
Ensembl Gene ENSMUSG00000031659
Gene Nameadenylate cyclase 7
Synonyms
MMRRC Submission 042824-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R5253 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location88272403-88329962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88314114 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 327 (I327T)
Ref Sequence ENSEMBL: ENSMUSP00000132528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098521] [ENSMUST00000168545] [ENSMUST00000169037] [ENSMUST00000171456]
Predicted Effect probably damaging
Transcript: ENSMUST00000098521
AA Change: I327T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096122
Gene: ENSMUSG00000031659
AA Change: I327T

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168545
AA Change: I327T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129252
Gene: ENSMUSG00000031659
AA Change: I327T

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169037
AA Change: I327T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130594
Gene: ENSMUSG00000031659
AA Change: I327T

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171456
AA Change: I327T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132528
Gene: ENSMUSG00000031659
AA Change: I327T

DomainStartEndE-ValueType
low complexity region 91 104 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 1.2e-35 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect unknown
Transcript: ENSMUST00000210688
AA Change: I27T
Meta Mutation Damage Score 0.7794 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound adenylate cyclase that catalyses the formation of cyclic AMP from ATP and is inhibitable by calcium. The product of this gene is a member of the adenylyl cyclase class-4/guanylyl cyclase enzyme family that is characterized by the presence of twelve membrane-spanning domains in its sequences. Several transcript variants have been observed for this gene, but the full-length natures of only two have been determined so far. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display some degree of pre- or postnatal lethality. Surviving adults for one allele appear to be normal. Heterozygous females for one allele display decreased depression related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T C 9: 40,051,450 noncoding transcript Het
Actrt2 A C 4: 154,667,569 S37A possibly damaging Het
Ankrd13b A G 11: 77,473,235 probably benign Het
Arap1 A C 7: 101,388,644 I237L probably benign Het
Arhgap17 A T 7: 123,303,748 Y359N probably benign Het
Atad1 A G 19: 32,674,302 M343T probably benign Het
Cacna1b A T 2: 24,719,952 I392N probably damaging Het
Cacna1c A G 6: 118,597,969 S1914P probably benign Het
Cd300a G T 11: 114,894,751 R174L probably benign Het
Dip2a G A 10: 76,299,997 P356L probably damaging Het
Dsg1c T C 18: 20,272,379 L283P probably damaging Het
Dusp1 T C 17: 26,508,217 N36S probably benign Het
Ercc3 C A 18: 32,269,864 P776Q probably damaging Het
Etv1 A G 12: 38,852,249 R260G possibly damaging Het
Fa2h C G 8: 111,349,237 M251I probably benign Het
Flg2 A G 3: 93,200,812 D49G probably damaging Het
Fras1 A G 5: 96,741,025 E2810G probably damaging Het
Fuk T C 8: 110,883,867 E968G possibly damaging Het
Gabbr1 T C 17: 37,055,913 F343S possibly damaging Het
Gdf2 A G 14: 33,945,307 T329A probably benign Het
Hcn4 T A 9: 58,824,275 I255N unknown Het
Hk3 T G 13: 55,011,011 D485A probably damaging Het
Hook3 T C 8: 26,072,291 T249A probably benign Het
Kcp C T 6: 29,498,520 probably benign Het
Kifc2 G T 15: 76,666,281 R515L possibly damaging Het
Kiss1r A G 10: 79,920,750 Y142C probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klrb1a T A 6: 128,619,163 I72L probably benign Het
Lep T A 6: 29,070,863 F62Y probably damaging Het
Lrtm1 A G 14: 29,021,844 T90A probably benign Het
Mug1 A T 6: 121,888,913 D1472V probably benign Het
Ncor2 G T 5: 125,026,930 P1988Q probably benign Het
Nlrp4a C T 7: 26,450,492 S508L probably benign Het
Obp2b T A 2: 25,737,143 D29E probably benign Het
Olfr1123 G A 2: 87,418,668 V207M possibly damaging Het
Olfr1214 A G 2: 88,988,100 L34P possibly damaging Het
Olfr1224-ps1 A T 2: 89,156,457 C239* probably null Het
Olfr725 T C 14: 50,035,288 I38M possibly damaging Het
Olfr803 A G 10: 129,691,732 I103T probably damaging Het
Otof A G 5: 30,370,139 S1985P probably damaging Het
Oxct2a A T 4: 123,323,093 V165E probably damaging Het
Papd5 C A 8: 88,200,023 H20Q possibly damaging Het
Pcdhgb7 T C 18: 37,753,097 V440A possibly damaging Het
Pelp1 C A 11: 70,401,661 G211C probably damaging Het
Phox2a A G 7: 101,822,105 H268R probably benign Het
Pik3c2g T C 6: 139,896,257 probably null Het
Pramel1 T A 4: 143,398,586 M360K probably benign Het
Rbm6 C T 9: 107,852,657 R132K probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc45a1 T C 4: 150,638,270 T386A probably damaging Het
Smad2 A G 18: 76,288,053 Y151C probably damaging Het
Sptbn2 G A 19: 4,750,082 G2188D probably benign Het
Sugt1 G A 14: 79,602,901 probably null Het
Tctn3 T C 19: 40,607,241 S367G probably benign Het
Tead1 G T 7: 112,861,545 D219Y probably damaging Het
Tenm2 G T 11: 36,047,201 Y1548* probably null Het
Tenm3 T A 8: 48,229,198 I2466F possibly damaging Het
Tgm2 G A 2: 158,129,438 P294S probably damaging Het
Tns2 T C 15: 102,111,453 S585P probably damaging Het
Ttc41 A G 10: 86,730,942 K491E probably benign Het
Ttn G A 2: 76,791,551 T15549I probably damaging Het
Vmn1r157 T C 7: 22,761,758 L21P probably damaging Het
Vmn2r81 A G 10: 79,247,986 M65V probably benign Het
Wdr34 T A 2: 30,032,363 probably benign Het
Zcchc14 T C 8: 121,618,694 probably benign Het
Other mutations in Adcy7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Adcy7 APN 8 88318790 splice site probably benign
IGL01434:Adcy7 APN 8 88324844 missense probably damaging 1.00
IGL01784:Adcy7 APN 8 88314123 missense probably damaging 1.00
IGL02506:Adcy7 APN 8 88317943 missense probably damaging 1.00
IGL03184:Adcy7 APN 8 88308643 missense probably benign 0.00
IGL03406:Adcy7 APN 8 88318319 nonsense probably null
Churchill UTSW 8 88315759 missense probably damaging 1.00
democracy UTSW 8 88315756 missense probably damaging 1.00
periphery UTSW 8 88317937 missense probably benign 0.01
R6287_adcy7_270 UTSW 8 88311108 missense possibly damaging 0.80
republic UTSW 8 88314137 missense probably damaging 1.00
tyranny UTSW 8 88312228 missense possibly damaging 0.76
PIT4283001:Adcy7 UTSW 8 88315492 missense probably damaging 1.00
PIT4453001:Adcy7 UTSW 8 88323636 missense probably benign 0.07
R0265:Adcy7 UTSW 8 88324763 missense probably damaging 0.96
R0963:Adcy7 UTSW 8 88312265 missense probably damaging 1.00
R0990:Adcy7 UTSW 8 88325452 missense possibly damaging 0.57
R1055:Adcy7 UTSW 8 88318057 splice site probably benign
R1494:Adcy7 UTSW 8 88320207 missense probably benign 0.00
R1764:Adcy7 UTSW 8 88308840 missense probably benign 0.00
R2062:Adcy7 UTSW 8 88312274 missense probably damaging 1.00
R2090:Adcy7 UTSW 8 88315857 missense probably damaging 0.98
R2201:Adcy7 UTSW 8 88317978 missense probably damaging 1.00
R2413:Adcy7 UTSW 8 88309818 missense probably benign 0.20
R2849:Adcy7 UTSW 8 88327393 missense probably benign 0.38
R4020:Adcy7 UTSW 8 88308734 missense probably benign 0.00
R4086:Adcy7 UTSW 8 88315786 missense probably benign 0.01
R4679:Adcy7 UTSW 8 88317937 missense probably benign 0.01
R5069:Adcy7 UTSW 8 88327697 missense probably damaging 1.00
R5286:Adcy7 UTSW 8 88324859 missense probably damaging 1.00
R5427:Adcy7 UTSW 8 88326201 critical splice donor site probably null
R5457:Adcy7 UTSW 8 88311021 missense probably damaging 1.00
R5689:Adcy7 UTSW 8 88324784 missense probably benign 0.00
R5907:Adcy7 UTSW 8 88312228 missense possibly damaging 0.76
R5909:Adcy7 UTSW 8 88325496 missense probably damaging 1.00
R5997:Adcy7 UTSW 8 88326392 missense probably benign 0.41
R6038:Adcy7 UTSW 8 88322980 missense probably benign 0.01
R6038:Adcy7 UTSW 8 88322980 missense probably benign 0.01
R6133:Adcy7 UTSW 8 88325439 missense possibly damaging 0.84
R6190:Adcy7 UTSW 8 88325730 splice site probably null
R6213:Adcy7 UTSW 8 88314137 missense probably damaging 1.00
R6287:Adcy7 UTSW 8 88311108 missense possibly damaging 0.80
R6502:Adcy7 UTSW 8 88325479 missense probably damaging 1.00
R6989:Adcy7 UTSW 8 88308786 missense probably benign
R7042:Adcy7 UTSW 8 88315750 missense probably damaging 0.99
R7829:Adcy7 UTSW 8 88315759 missense probably damaging 1.00
R8067:Adcy7 UTSW 8 88311069 missense probably damaging 1.00
R8113:Adcy7 UTSW 8 88321803 missense probably damaging 1.00
R8118:Adcy7 UTSW 8 88315756 missense probably damaging 1.00
R8190:Adcy7 UTSW 8 88311038 missense possibly damaging 0.49
R8402:Adcy7 UTSW 8 88308735 missense probably benign 0.30
R8421:Adcy7 UTSW 8 88322184 missense probably benign 0.06
R8549:Adcy7 UTSW 8 88326190 missense probably benign
R8827:Adcy7 UTSW 8 88309699 missense possibly damaging 0.73
X0067:Adcy7 UTSW 8 88324600 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGTCCTTCCTGCATAGCC -3'
(R):5'- GAATCCAGGTAAGCCCCATC -3'

Sequencing Primer
(F):5'- CAAACCTTGCTTTCATCTGGG -3'
(R):5'- GGTAAGCCCCATCCACCC -3'
Posted On2016-07-06