Incidental Mutation 'R0455:Nus1'
Institutional Source Beutler Lab
Gene Symbol Nus1
Ensembl Gene ENSMUSG00000023068
Gene NameNUS1 dehydrodolichyl diphosphate synthase subunit
Synonyms1600027K07Rik, D10Ertd438e, NgBR
MMRRC Submission 038655-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0455 (G1)
Quality Score225
Status Validated
Chromosomal Location52417547-52440183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52430094 bp
Amino Acid Change Valine to Glutamic Acid at position 42 (V42E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023830
AA Change: V194E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023830
Gene: ENSMUSG00000023068
AA Change: V194E

low complexity region 12 26 N/A INTRINSIC
low complexity region 63 88 N/A INTRINSIC
Pfam:Prenyltransf 105 296 2.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161678
AA Change: V42E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124767
Gene: ENSMUSG00000023068
AA Change: V42E

SCOP:d1f75a_ 1 91 1e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218983
Meta Mutation Damage Score 0.8629 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die prior to E6.5. MEFs homozygous for a conditionally activated knock-out allele exhibit impaired glycosylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,230,983 G342D possibly damaging Het
Acvr2b C T 9: 119,432,609 R399W probably damaging Het
AI464131 G A 4: 41,499,538 R31* probably null Het
Atf6 A G 1: 170,834,923 V256A probably benign Het
Atp2b4 A T 1: 133,728,716 I732N probably damaging Het
C1qtnf9 A C 14: 60,772,371 Q25H probably damaging Het
Ccdc6 T A 10: 70,142,571 probably benign Het
Cds2 T C 2: 132,285,967 probably null Het
Chdh A G 14: 30,034,646 Y343C probably damaging Het
Col5a2 T C 1: 45,382,102 probably benign Het
Cts3 G A 13: 61,568,210 probably benign Het
Cyfip1 T A 7: 55,892,054 D362E probably benign Het
Dsg1b T A 18: 20,396,025 S273T probably benign Het
Dysf A T 6: 84,140,667 H1274L probably benign Het
Eva1c T C 16: 90,876,098 S187P probably benign Het
Fam126b T C 1: 58,534,479 probably benign Het
Fam13b G A 18: 34,445,528 probably benign Het
Fam172a T A 13: 77,834,713 probably benign Het
Fbn2 C T 18: 58,035,336 G2310S probably damaging Het
Fcna T C 2: 25,625,508 Y183C probably damaging Het
Fnta T C 8: 26,001,028 T263A probably benign Het
Gm94 T C 18: 43,781,244 D83G possibly damaging Het
Gnal C T 18: 67,135,649 probably benign Het
Grb7 T G 11: 98,452,188 S244A probably benign Het
Grm3 T C 5: 9,512,477 T458A probably benign Het
Hdac2 C T 10: 36,991,836 R193C probably damaging Het
Ighmbp2 T C 19: 3,265,072 R783G probably benign Het
Inpp5j G T 11: 3,503,122 L43I possibly damaging Het
Itga11 A T 9: 62,696,961 T44S probably damaging Het
Itsn1 C T 16: 91,868,148 probably benign Het
Kdm6b G T 11: 69,406,996 C233* probably null Het
Lamb3 T C 1: 193,343,392 L1130P probably damaging Het
Lrch3 T C 16: 32,986,880 F508L probably damaging Het
Lrrd1 T A 5: 3,866,425 V814E probably benign Het
Megf10 C T 18: 57,252,982 P356S probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Olfr435 A C 6: 43,202,072 M143L probably benign Het
Olfr739 A G 14: 50,424,902 I128V possibly damaging Het
Padi3 T C 4: 140,795,713 N306S probably damaging Het
Pex13 T C 11: 23,655,949 S94G probably benign Het
Ppm1h G T 10: 122,802,324 Q166H probably benign Het
Ptafr A T 4: 132,580,085 Y262F probably benign Het
Rabgap1 T A 2: 37,487,120 D321E probably damaging Het
Samsn1 C T 16: 75,945,225 noncoding transcript Het
Scarb1 T C 5: 125,289,681 N63D probably damaging Het
Serpinb7 T C 1: 107,451,610 I249T possibly damaging Het
Srpr A G 9: 35,214,981 K490R probably benign Het
Sycn A G 7: 28,540,973 N22D probably benign Het
Tarbp1 C T 8: 126,440,873 A1067T probably benign Het
Tex14 A G 11: 87,514,305 D681G possibly damaging Het
Usp34 C T 11: 23,446,741 probably benign Het
Vmn2r107 T C 17: 20,374,823 probably benign Het
Vwde A T 6: 13,187,529 M653K probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Other mutations in Nus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Nus1 APN 10 52430067 missense probably benign
IGL01983:Nus1 APN 10 52436657 missense probably damaging 0.98
IGL02195:Nus1 APN 10 52433369 missense probably damaging 1.00
R0173:Nus1 UTSW 10 52417998 missense possibly damaging 0.53
R5377:Nus1 UTSW 10 52429213 missense possibly damaging 0.73
R5792:Nus1 UTSW 10 52429256 nonsense probably null
R6009:Nus1 UTSW 10 52433443 missense probably benign
R8147:Nus1 UTSW 10 52429320 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ccctgacaagaactgaaatacac -3'
Posted On2013-05-23