Incidental Mutation 'R0455:Wrap73'
ID 39949
Institutional Source Beutler Lab
Gene Symbol Wrap73
Ensembl Gene ENSMUSG00000029029
Gene Name WD repeat containing, antisense to Trp73
Synonyms DD57, Wdr8, 5330425N03Rik, 2610044M17Rik
MMRRC Submission 038655-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock # R0455 (G1)
Quality Score 214
Status Validated
Chromosome 4
Chromosomal Location 154142372-154167420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 154148743 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 125 (S125T)
Ref Sequence ENSEMBL: ENSMUSP00000030895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030895]
AlphaFold Q9JM98
Predicted Effect possibly damaging
Transcript: ENSMUST00000030895
AA Change: S125T

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030895
Gene: ENSMUSG00000029029
AA Change: S125T

DomainStartEndE-ValueType
Blast:WD40 38 77 4e-18 BLAST
Blast:WD40 81 120 6e-16 BLAST
Blast:WD40 125 163 9e-6 BLAST
WD40 167 208 2.28e2 SMART
WD40 215 251 1.58e-2 SMART
WD40 319 360 2.29e1 SMART
WD40 363 401 4.18e-2 SMART
Blast:WD40 402 443 2e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142665
Predicted Effect probably benign
Transcript: ENSMUST00000146734
SMART Domains Protein: ENSMUSP00000118548
Gene: ENSMUSG00000029029

DomainStartEndE-ValueType
WD40 28 64 1.58e-2 SMART
Meta Mutation Damage Score 0.0698 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Studies of the related mouse protein suggest that the encoded protein may play a role in the process of ossification. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,230,983 G342D possibly damaging Het
Acvr2b C T 9: 119,432,609 R399W probably damaging Het
AI464131 G A 4: 41,499,538 R31* probably null Het
Atf6 A G 1: 170,834,923 V256A probably benign Het
Atp2b4 A T 1: 133,728,716 I732N probably damaging Het
C1qtnf9 A C 14: 60,772,371 Q25H probably damaging Het
Ccdc6 T A 10: 70,142,571 probably benign Het
Cds2 T C 2: 132,285,967 probably null Het
Chdh A G 14: 30,034,646 Y343C probably damaging Het
Col5a2 T C 1: 45,382,102 probably benign Het
Cts3 G A 13: 61,568,210 probably benign Het
Cyfip1 T A 7: 55,892,054 D362E probably benign Het
Dsg1b T A 18: 20,396,025 S273T probably benign Het
Dysf A T 6: 84,140,667 H1274L probably benign Het
Eva1c T C 16: 90,876,098 S187P probably benign Het
Fam126b T C 1: 58,534,479 probably benign Het
Fam13b G A 18: 34,445,528 probably benign Het
Fam172a T A 13: 77,834,713 probably benign Het
Fbn2 C T 18: 58,035,336 G2310S probably damaging Het
Fcna T C 2: 25,625,508 Y183C probably damaging Het
Fnta T C 8: 26,001,028 T263A probably benign Het
Gm94 T C 18: 43,781,244 D83G possibly damaging Het
Gnal C T 18: 67,135,649 probably benign Het
Grb7 T G 11: 98,452,188 S244A probably benign Het
Grm3 T C 5: 9,512,477 T458A probably benign Het
Hdac2 C T 10: 36,991,836 R193C probably damaging Het
Ighmbp2 T C 19: 3,265,072 R783G probably benign Het
Inpp5j G T 11: 3,503,122 L43I possibly damaging Het
Itga11 A T 9: 62,696,961 T44S probably damaging Het
Itsn1 C T 16: 91,868,148 probably benign Het
Kdm6b G T 11: 69,406,996 C233* probably null Het
Lamb3 T C 1: 193,343,392 L1130P probably damaging Het
Lrch3 T C 16: 32,986,880 F508L probably damaging Het
Lrrd1 T A 5: 3,866,425 V814E probably benign Het
Megf10 C T 18: 57,252,982 P356S probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nus1 T A 10: 52,430,094 V42E probably damaging Het
Olfr435 A C 6: 43,202,072 M143L probably benign Het
Olfr739 A G 14: 50,424,902 I128V possibly damaging Het
Padi3 T C 4: 140,795,713 N306S probably damaging Het
Pex13 T C 11: 23,655,949 S94G probably benign Het
Ppm1h G T 10: 122,802,324 Q166H probably benign Het
Ptafr A T 4: 132,580,085 Y262F probably benign Het
Rabgap1 T A 2: 37,487,120 D321E probably damaging Het
Samsn1 C T 16: 75,945,225 noncoding transcript Het
Scarb1 T C 5: 125,289,681 N63D probably damaging Het
Serpinb7 T C 1: 107,451,610 I249T possibly damaging Het
Srpr A G 9: 35,214,981 K490R probably benign Het
Sycn A G 7: 28,540,973 N22D probably benign Het
Tarbp1 C T 8: 126,440,873 A1067T probably benign Het
Tex14 A G 11: 87,514,305 D681G possibly damaging Het
Usp34 C T 11: 23,446,741 probably benign Het
Vmn2r107 T C 17: 20,374,823 probably benign Het
Vwde A T 6: 13,187,529 M653K probably benign Het
Other mutations in Wrap73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Wrap73 APN 4 154152639 missense probably damaging 0.99
IGL01562:Wrap73 APN 4 154145337 missense possibly damaging 0.63
IGL01863:Wrap73 APN 4 154145333 missense probably benign 0.02
IGL02342:Wrap73 APN 4 154148780 missense probably benign 0.36
IGL03012:Wrap73 APN 4 154145234 splice site probably benign
IGL03303:Wrap73 APN 4 154146543 missense probably damaging 0.98
R0128:Wrap73 UTSW 4 154142500 missense possibly damaging 0.81
R0524:Wrap73 UTSW 4 154145307 missense probably damaging 1.00
R0528:Wrap73 UTSW 4 154145319 missense probably damaging 1.00
R0533:Wrap73 UTSW 4 154151649 missense probably damaging 1.00
R0533:Wrap73 UTSW 4 154156154 missense possibly damaging 0.91
R0633:Wrap73 UTSW 4 154142491 missense probably damaging 0.98
R1118:Wrap73 UTSW 4 154152427 splice site probably null
R1669:Wrap73 UTSW 4 154156131 missense probably damaging 0.99
R1725:Wrap73 UTSW 4 154148752 missense possibly damaging 0.73
R2070:Wrap73 UTSW 4 154148743 missense possibly damaging 0.63
R4530:Wrap73 UTSW 4 154156707 unclassified probably benign
R4669:Wrap73 UTSW 4 154151696 missense probably benign 0.26
R4969:Wrap73 UTSW 4 154152681 missense probably damaging 1.00
R5254:Wrap73 UTSW 4 154155346 missense probably benign 0.00
R5334:Wrap73 UTSW 4 154145274 missense probably damaging 0.97
R5428:Wrap73 UTSW 4 154145274 missense probably damaging 0.97
R5431:Wrap73 UTSW 4 154145274 missense probably damaging 0.97
R5728:Wrap73 UTSW 4 154154642 critical splice donor site probably null
R7338:Wrap73 UTSW 4 154152586 missense probably benign 0.26
R7426:Wrap73 UTSW 4 154156127 missense probably damaging 1.00
R7480:Wrap73 UTSW 4 154152586 missense probably benign 0.26
R7680:Wrap73 UTSW 4 154156622 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GGTCATAGACAGGTCACCGCACA -3'
(R):5'- TGCACAGTGATGGAAGCTGGG -3'

Sequencing Primer
(F):5'- ACTTGAGCAGTAAGGCTTCC -3'
(R):5'- ATGGAAGCTGGGGGAGG -3'
Posted On 2013-05-23