Incidental Mutation 'R5241:Bsnd'
ID400808
Institutional Source Beutler Lab
Gene Symbol Bsnd
Ensembl Gene ENSMUSG00000025418
Gene Namebarttin CLCNK type accessory beta subunit
Synonyms
MMRRC Submission 042812-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5241 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location106483456-106492283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106487985 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 88 (V88A)
Ref Sequence ENSEMBL: ENSMUSP00000049563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054472]
Predicted Effect probably benign
Transcript: ENSMUST00000054472
AA Change: V88A

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049563
Gene: ENSMUSG00000025418
AA Change: V88A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Barttin 27 241 5.2e-110 PFAM
low complexity region 273 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential beta subunit for CLC chloride channels. These heteromeric channels localize to basolateral membranes of renal tubules and of potassium-secreting epithelia of the inner ear. Mutations in this gene have been associated with Bartter syndrome with sensorineural deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe dehydration and postnatal lethality. Mice homozygous for a cre-activated conditional allele exhibit hearing loss with outer hair cell and stria vascularis degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930033H14Rik A G 10: 69,212,751 probably null Het
Adgrb3 T C 1: 25,111,790 T881A possibly damaging Het
Adgrv1 A T 13: 81,488,929 C3464* probably null Het
Afp A G 5: 90,501,614 M347V probably benign Het
Apc2 A G 10: 80,312,234 T1041A probably benign Het
Atl1 T C 12: 69,959,113 S398P possibly damaging Het
Atp8b4 G A 2: 126,383,726 P528L probably benign Het
Bahcc1 C A 11: 120,271,403 P176T probably damaging Het
Dnah7c T A 1: 46,530,500 F687Y probably benign Het
Dok6 T C 18: 89,598,789 I23M possibly damaging Het
Fcgbp A T 7: 28,085,199 D228V probably damaging Het
Gatad2a G A 8: 69,918,017 Q107* probably null Het
Glis3 G T 19: 28,350,023 T663K probably benign Het
Gm10784 T A 13: 49,945,093 noncoding transcript Het
Gsdmc2 C T 15: 63,824,894 R476H probably benign Het
Gsdmc3 A G 15: 63,864,146 S202P possibly damaging Het
Map3k8 T C 18: 4,340,750 E188G probably damaging Het
Mccc1 T A 3: 35,974,196 Q487L probably benign Het
Msantd1 A G 5: 34,921,469 D116G probably damaging Het
Myh1 T A 11: 67,204,449 S212T probably benign Het
Nr1h4 A G 10: 89,483,489 Y158H probably damaging Het
Olfr1180 T C 2: 88,412,098 T187A possibly damaging Het
Olfr421-ps1 T A 1: 174,152,101 I195N probably benign Het
Olfr585 T C 7: 103,098,317 V192A probably benign Het
Pcnt A T 10: 76,433,617 H272Q probably benign Het
Pdia5 T C 16: 35,429,775 N242S probably benign Het
Pkd1l2 A T 8: 117,035,118 D1441E probably damaging Het
Runx2 G T 17: 44,639,777 Y203* probably null Het
Sdr9c7 T G 10: 127,909,790 I257S probably benign Het
Slitrk1 A G 14: 108,913,012 M89T probably benign Het
St14 G T 9: 31,100,418 C397* probably null Het
Tas2r123 T C 6: 132,847,218 I26T probably benign Het
Tmem144 A T 3: 79,814,124 M329K probably benign Het
Tmem252 T C 19: 24,674,127 M20T probably benign Het
Umodl1 T C 17: 30,984,092 V473A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Xirp2 C T 2: 67,482,360 R58* probably null Het
Zer1 A C 2: 30,104,970 L471R probably damaging Het
Zfp101 C T 17: 33,382,236 C182Y probably benign Het
Other mutations in Bsnd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03220:Bsnd APN 4 106486765 missense possibly damaging 0.58
IGL02802:Bsnd UTSW 4 106492034 missense probably damaging 1.00
R1327:Bsnd UTSW 4 106486612 missense probably benign 0.08
R1869:Bsnd UTSW 4 106486636 missense probably benign 0.03
R1912:Bsnd UTSW 4 106488030 nonsense probably null
R4294:Bsnd UTSW 4 106485158 missense probably benign 0.01
R4411:Bsnd UTSW 4 106486671 missense probably benign
R5733:Bsnd UTSW 4 106488001 missense probably benign 0.08
R6274:Bsnd UTSW 4 106486635 missense probably damaging 0.96
R6483:Bsnd UTSW 4 106488015 missense probably damaging 0.99
R7153:Bsnd UTSW 4 106492033 missense probably benign 0.09
R7184:Bsnd UTSW 4 106491912 missense probably damaging 1.00
X0023:Bsnd UTSW 4 106485417 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACCTACGATTTCAAAGAGTGTG -3'
(R):5'- CCTTCCGCTGTACAATGCAG -3'

Sequencing Primer
(F):5'- CCTACGATTTCAAAGAGTGTGTTCTC -3'
(R):5'- CTTCCGCTGTACAATGCAGAAAAGG -3'
Posted On2016-07-06