Incidental Mutation 'R5733:Bsnd'
ID451527
Institutional Source Beutler Lab
Gene Symbol Bsnd
Ensembl Gene ENSMUSG00000025418
Gene Namebarttin CLCNK type accessory beta subunit
Synonyms
MMRRC Submission 043193-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5733 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location106483456-106492283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106488001 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 83 (T83A)
Ref Sequence ENSEMBL: ENSMUSP00000049563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054472]
Predicted Effect probably benign
Transcript: ENSMUST00000054472
AA Change: T83A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000049563
Gene: ENSMUSG00000025418
AA Change: T83A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Barttin 27 241 5.2e-110 PFAM
low complexity region 273 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential beta subunit for CLC chloride channels. These heteromeric channels localize to basolateral membranes of renal tubules and of potassium-secreting epithelia of the inner ear. Mutations in this gene have been associated with Bartter syndrome with sensorineural deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe dehydration and postnatal lethality. Mice homozygous for a cre-activated conditional allele exhibit hearing loss with outer hair cell and stria vascularis degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,245,080 S76T probably damaging Het
Acox3 T A 5: 35,605,199 probably null Het
Ahnak2 A T 12: 112,775,666 Y657* probably null Het
Anxa3 T A 5: 96,820,472 I128N probably damaging Het
Capn10 A G 1: 92,943,913 Y411C probably benign Het
Capn3 G A 2: 120,484,594 W201* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
Daam1 A G 12: 71,945,498 D329G unknown Het
Dmxl2 A T 9: 54,376,266 L2761Q possibly damaging Het
Dpcr1 T C 17: 35,638,210 M166V probably benign Het
Fcho2 A C 13: 98,789,802 V91G probably damaging Het
Fen1 A T 19: 10,200,658 C141S possibly damaging Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Frmd4a A T 2: 4,300,957 R14S possibly damaging Het
Fzr1 A G 10: 81,370,326 F176L possibly damaging Het
Garem2 A G 5: 30,116,338 D565G probably damaging Het
Iqca G T 1: 90,070,535 T549K probably damaging Het
Itgax T A 7: 128,140,475 S686R probably damaging Het
Knop1 C A 7: 118,846,082 G220C probably damaging Het
Lyzl1 T A 18: 4,169,142 C49S probably damaging Het
Mpzl1 A T 1: 165,605,611 I157K probably benign Het
Mrgprb2 T C 7: 48,552,513 I155V probably benign Het
Mvb12b T C 2: 33,827,716 T167A probably benign Het
Myh3 A G 11: 67,088,619 N491S probably benign Het
Myo5b A G 18: 74,654,057 D511G possibly damaging Het
Olfr1053 T G 2: 86,315,214 Q24P probably damaging Het
Olfr1329 C T 4: 118,916,838 V210I probably benign Het
Olfr449 C T 6: 42,838,246 R122C probably damaging Het
Olfr749 T C 14: 50,737,052 T37A probably benign Het
Ptcd1 A G 5: 145,154,861 M476T probably damaging Het
Pum3 A G 19: 27,421,295 probably null Het
Ranbp2 G A 10: 58,485,836 D2652N probably damaging Het
Rassf1 T C 9: 107,558,014 V166A probably damaging Het
Rictor A G 15: 6,783,104 H907R probably benign Het
Rorb T C 19: 18,988,107 E6G probably damaging Het
Serpina3f A T 12: 104,216,923 T15S possibly damaging Het
Sorbs2 T C 8: 45,759,189 L100P probably damaging Het
Sprr2k T C 3: 92,433,348 probably benign Het
Srrm2 T A 17: 23,821,386 S2431T probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Ttc21a G A 9: 119,941,261 V133I probably benign Het
Vasn T C 16: 4,650,162 Y658H possibly damaging Het
Zfp251 A G 15: 76,870,327 Y35H probably damaging Het
Other mutations in Bsnd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03220:Bsnd APN 4 106486765 missense possibly damaging 0.58
IGL02802:Bsnd UTSW 4 106492034 missense probably damaging 1.00
R1327:Bsnd UTSW 4 106486612 missense probably benign 0.08
R1869:Bsnd UTSW 4 106486636 missense probably benign 0.03
R1912:Bsnd UTSW 4 106488030 nonsense probably null
R4294:Bsnd UTSW 4 106485158 missense probably benign 0.01
R4411:Bsnd UTSW 4 106486671 missense probably benign
R5241:Bsnd UTSW 4 106487985 missense probably benign 0.21
R6274:Bsnd UTSW 4 106486635 missense probably damaging 0.96
R6483:Bsnd UTSW 4 106488015 missense probably damaging 0.99
R7153:Bsnd UTSW 4 106492033 missense probably benign 0.09
R7184:Bsnd UTSW 4 106491912 missense probably damaging 1.00
X0023:Bsnd UTSW 4 106485417 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGTTCTCAGAAAATTCAAGGC -3'
(R):5'- TCAAGCAGAGACCCTTCCAG -3'

Sequencing Primer
(F):5'- TTCTCAGAAAATTCAAGGCAAGGAG -3'
(R):5'- CTTCCGCTGTACAATGCAGAAAAGG -3'
Posted On2017-01-03