Incidental Mutation 'R5432:Sephs2'
ID428094
Institutional Source Beutler Lab
Gene Symbol Sephs2
Ensembl Gene ENSMUSG00000049091
Gene Nameselenophosphate synthetase 2
SynonymsSps2, Ysg3
MMRRC Submission 042997-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R5432 (G1)
Quality Score89
Status Not validated
Chromosome7
Chromosomal Location127271879-127274055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127273805 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 39 (R39W)
Ref Sequence ENSEMBL: ENSMUSP00000081009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082428]
Predicted Effect probably damaging
Transcript: ENSMUST00000082428
AA Change: R39W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081009
Gene: ENSMUSG00000049091
AA Change: R39W

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
Pfam:AIRS 118 234 1e-10 PFAM
Pfam:AIRS_C 246 421 2.3e-30 PFAM
low complexity region 433 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206759
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that synthesizes selenophosphate from selenide and ATP. Selenophosphate is the selenium donor used to synthesize selenocysteine (Sec) that is co-translationally incorporated into selenoproteins at in-frame UGA codons, which normally signal translation termination. This protein itself contains a Sec residue in its predicted active site. The 3' UTR of this gene has a stem-loop secondary structure called a selenocysteine insertion sequence (SECIS) element, which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt G A 9: 4,309,349 R30* probably null Het
Abca9 G A 11: 110,141,554 R746W possibly damaging Het
Akap13 A G 7: 75,602,830 E236G probably damaging Het
Asb4 A C 6: 5,430,912 R382S probably damaging Het
Bahcc1 T C 11: 120,287,988 S2458P probably benign Het
Bspry T C 4: 62,482,715 V148A probably benign Het
Cacna2d3 A C 14: 28,943,555 probably null Het
Cblb T A 16: 52,142,865 H390Q probably damaging Het
Cct8l1 T C 5: 25,516,307 S7P possibly damaging Het
Cep295 T C 9: 15,351,695 T191A possibly damaging Het
Cts8 A C 13: 61,251,012 F227V probably benign Het
Elac1 T C 18: 73,742,793 T56A possibly damaging Het
Fjx1 T C 2: 102,450,519 N357S possibly damaging Het
Gm14139 A G 2: 150,191,981 N74S possibly damaging Het
Gm340 A G 19: 41,584,603 E599G probably damaging Het
Gm5414 T C 15: 101,624,634 T453A probably damaging Het
Hcls1 G A 16: 36,961,548 E340K probably benign Het
Hrc C A 7: 45,336,861 H479N possibly damaging Het
Ikzf4 A G 10: 128,634,178 V491A probably damaging Het
Kalrn A G 16: 34,053,622 S138P probably damaging Het
Lama3 G T 18: 12,572,066 D3062Y probably damaging Het
Llgl1 T C 11: 60,707,623 S442P probably benign Het
Macf1 T A 4: 123,459,336 K1517* probably null Het
Myo9a A T 9: 59,865,670 Y995F possibly damaging Het
Nek3 A C 8: 22,148,732 probably null Het
Nynrin A G 14: 55,864,466 T531A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr164 A T 16: 19,286,089 I218N probably benign Het
Pdia4 A G 6: 47,798,466 V470A possibly damaging Het
Pinlyp T C 7: 24,542,467 D105G probably damaging Het
Pla2g6 A G 15: 79,302,617 probably null Het
Plpp7 A G 2: 32,095,920 S37G probably benign Het
Prdm11 G T 2: 92,975,813 P264Q probably benign Het
Rbl2 G T 8: 91,102,283 R604L probably benign Het
Rfx7 A G 9: 72,593,302 T115A probably benign Het
Samd4 A G 14: 47,074,062 Q279R probably benign Het
Sdha G T 13: 74,326,949 A591D probably damaging Het
Secisbp2 AAGCAGCAGCAGCAGCAGCA AAGCAGCAGCAGCAGCA 13: 51,673,966 probably benign Het
Serpina3f T C 12: 104,220,318 I381T possibly damaging Het
Shd A T 17: 55,976,214 Q281L probably damaging Het
Sik3 A G 9: 46,123,241 S98G probably benign Het
Srgap1 T A 10: 121,869,823 N232I probably damaging Het
Thbs1 A T 2: 118,114,683 N246Y probably benign Het
Usp9y A G Y: 1,368,022 probably null Het
Vwde A G 6: 13,190,592 M500T probably damaging Het
Wdr72 T G 9: 74,275,946 S1053R probably damaging Het
Yif1b T C 7: 29,245,968 C192R probably damaging Het
Zc3h13 A G 14: 75,331,247 S1327G probably damaging Het
Other mutations in Sephs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Sephs2 APN 7 127273087 missense probably benign 0.43
IGL03006:Sephs2 APN 7 127273034 missense probably benign
IGL03295:Sephs2 APN 7 127272769 missense possibly damaging 0.60
R1381:Sephs2 UTSW 7 127272967 missense probably damaging 1.00
R2259:Sephs2 UTSW 7 127273477 missense possibly damaging 0.80
R4876:Sephs2 UTSW 7 127273047 nonsense probably null
R5054:Sephs2 UTSW 7 127273392 missense probably benign 0.05
R6197:Sephs2 UTSW 7 127272901 missense probably damaging 1.00
R6237:Sephs2 UTSW 7 127273946 start gained probably benign
R7138:Sephs2 UTSW 7 127273015 missense possibly damaging 0.96
R7181:Sephs2 UTSW 7 127273820 missense probably benign
R7601:Sephs2 UTSW 7 127272946 missense probably damaging 1.00
R7685:Sephs2 UTSW 7 127273334 missense possibly damaging 0.46
X0061:Sephs2 UTSW 7 127273555 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GAGTCCATGCCAATGCTCAG -3'
(R):5'- ATCTGCAGGTATCTGGGCCTTC -3'

Sequencing Primer
(F):5'- ATGCCAATGCTCAGCGAGG -3'
(R):5'- CAGGTATCTGGGCCTTCTGGTC -3'
Posted On2016-09-01