Incidental Mutation 'R5464:Acyp2'
ID433173
Institutional Source Beutler Lab
Gene Symbol Acyp2
Ensembl Gene ENSMUSG00000060923
Gene Nameacylphosphatase 2, muscle type
Synonyms
MMRRC Submission 042850-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R5464 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location30505991-30649587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30506354 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 98 (E98K)
Ref Sequence ENSEMBL: ENSMUSP00000074195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074613]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074613
AA Change: E98K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074195
Gene: ENSMUSG00000060923
AA Change: E98K

DomainStartEndE-ValueType
Pfam:Acylphosphatase 10 105 1.5e-26 PFAM
Meta Mutation Damage Score 0.1234 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acylphosphatase can hydrolyze the phosphoenzyme intermediate of different membrane pumps, particularly the Ca2+/Mg2+-ATPase from sarcoplasmic reticulum of skeletal muscle. Two isoenzymes have been isolated, called muscle acylphosphatase and erythrocyte acylphosphatase on the basis of their tissue localization. This gene encodes the muscle-type isoform (MT). An increase of the MT isoform is associated with muscle differentiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
Acsl1 T A 8: 46,505,738 D95E probably benign Het
Adamts16 T A 13: 70,761,749 H895L probably benign Het
Alox12e T C 11: 70,317,679 Y483C probably damaging Het
Atp13a2 T A 4: 141,006,070 F952I probably damaging Het
Crot T G 5: 8,983,690 probably null Het
Dnaja1 T A 4: 40,724,133 M98K probably benign Het
Eps8 C T 6: 137,527,475 G87R probably damaging Het
Flg2 C A 3: 93,201,970 T435K possibly damaging Het
Gm16286 C T 18: 80,211,923 A144V probably damaging Het
Gpatch4 T C 3: 88,054,755 probably null Het
Heatr1 T A 13: 12,433,643 M1795K probably benign Het
Ift52 T C 2: 163,029,815 V189A probably benign Het
Kif21a T A 15: 90,993,855 D250V probably damaging Het
Lrrc66 T C 5: 73,608,279 T474A probably benign Het
Mcub T C 3: 129,915,716 E316G probably benign Het
Mettl15 C T 2: 109,191,622 V113I probably benign Het
Mroh8 T A 2: 157,221,230 I824F probably damaging Het
Mrpl19 A G 6: 81,962,011 M270T probably damaging Het
Olfr1187-ps1 T C 2: 88,540,255 Y58C probably null Het
Olfr33 T C 7: 102,713,682 T244A probably benign Het
Olfr559 A G 7: 102,723,917 V191A possibly damaging Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Olfr628 T A 7: 103,732,189 W88R probably damaging Het
Olfr644 C A 7: 104,068,467 R188L possibly damaging Het
Olfr963 A T 9: 39,669,770 T238S probably damaging Het
Olfr986 T C 9: 40,187,784 I223T probably damaging Het
Olfr993 AAGTCTGGAGTC AAGTC 2: 85,414,713 probably null Het
Pacs1 T C 19: 5,147,207 M430V probably benign Het
Piezo2 A G 18: 63,145,105 S243P probably damaging Het
Ppp1r36 A T 12: 76,428,078 probably null Het
Prdm16 T A 4: 154,346,144 probably null Het
Prss36 A T 7: 127,934,233 W97R probably damaging Het
Psmg4 A T 13: 34,178,064 I112F probably damaging Het
Ptpru C T 4: 131,772,557 G1259R probably damaging Het
Rsph4a T C 10: 33,909,341 I416T possibly damaging Het
Scn2a C T 2: 65,701,756 R571C probably damaging Het
Selenbp1 A G 3: 94,944,416 M423V probably benign Het
Serpina3i G A 12: 104,268,492 A361T possibly damaging Het
Serpinb3c A T 1: 107,271,704 D362E probably damaging Het
Sf3a3 T C 4: 124,728,240 probably null Het
Sgcg A G 14: 61,236,855 V113A possibly damaging Het
Slc3a2 T C 19: 8,713,644 K74R probably damaging Het
Smco1 T A 16: 32,273,876 W122R probably damaging Het
Snx19 A G 9: 30,427,973 K136E possibly damaging Het
Trim32 A G 4: 65,614,388 N394S probably damaging Het
Uqcrb T C 13: 66,900,825 D87G probably damaging Het
Wipf3 T C 6: 54,485,323 S173P possibly damaging Het
Zfp473 T C 7: 44,732,638 E756G probably damaging Het
Other mutations in Acyp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01587:Acyp2 APN 11 30506362 missense probably benign 0.07
IGL02365:Acyp2 APN 11 30649318 missense probably damaging 1.00
R1470:Acyp2 UTSW 11 30506452 splice site probably benign
R2419:Acyp2 UTSW 11 30632316 missense probably benign 0.20
R5389:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5393:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5423:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5425:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5426:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5460:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5462:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5560:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5561:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5602:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5826:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5901:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5902:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5999:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6046:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6066:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6107:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6128:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6196:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6198:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGCTTGCTAAAACATAGGTGAG -3'
(R):5'- GCAAGGTAATACTGACCTTGAAG -3'

Sequencing Primer
(F):5'- AGGTGAGTAAATGTTTTCAGTTTCAG -3'
(R):5'- GGTAATACTGACCTTGAAGAGTTTG -3'
Posted On2016-10-06