Incidental Mutation 'R5464:Sf3a3'
ID 433150
Institutional Source Beutler Lab
Gene Symbol Sf3a3
Ensembl Gene ENSMUSG00000028902
Gene Name splicing factor 3a, subunit 3
Synonyms 4930512K19Rik, 60kDa
MMRRC Submission 042850-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R5464 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 124714776-124732460 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 124728240 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030734]
AlphaFold Q9D554
Predicted Effect probably null
Transcript: ENSMUST00000030734
SMART Domains Protein: ENSMUSP00000030734
Gene: ENSMUSG00000028902

DomainStartEndE-ValueType
Pfam:SF3a60_bindingd 74 100 3e-19 PFAM
Pfam:SF3A3 129 207 7.9e-27 PFAM
Pfam:Telomere_Sde2_2 244 303 3.1e-31 PFAM
low complexity region 354 377 N/A INTRINSIC
ZnF_C2H2 406 431 9.3e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151049
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 3 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 3 interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. This gene has a pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
Acsl1 T A 8: 46,505,738 D95E probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts16 T A 13: 70,761,749 H895L probably benign Het
Alox12e T C 11: 70,317,679 Y483C probably damaging Het
Atp13a2 T A 4: 141,006,070 F952I probably damaging Het
Crot T G 5: 8,983,690 probably null Het
Dnaja1 T A 4: 40,724,133 M98K probably benign Het
Eps8 C T 6: 137,527,475 G87R probably damaging Het
Flg2 C A 3: 93,201,970 T435K possibly damaging Het
Gm16286 C T 18: 80,211,923 A144V probably damaging Het
Gpatch4 T C 3: 88,054,755 probably null Het
Heatr1 T A 13: 12,433,643 M1795K probably benign Het
Ift52 T C 2: 163,029,815 V189A probably benign Het
Kif21a T A 15: 90,993,855 D250V probably damaging Het
Lrrc66 T C 5: 73,608,279 T474A probably benign Het
Mcub T C 3: 129,915,716 E316G probably benign Het
Mettl15 C T 2: 109,191,622 V113I probably benign Het
Mroh8 T A 2: 157,221,230 I824F probably damaging Het
Mrpl19 A G 6: 81,962,011 M270T probably damaging Het
Olfr1187-ps1 T C 2: 88,540,255 Y58C probably null Het
Olfr33 T C 7: 102,713,682 T244A probably benign Het
Olfr559 A G 7: 102,723,917 V191A possibly damaging Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Olfr628 T A 7: 103,732,189 W88R probably damaging Het
Olfr644 C A 7: 104,068,467 R188L possibly damaging Het
Olfr963 A T 9: 39,669,770 T238S probably damaging Het
Olfr986 T C 9: 40,187,784 I223T probably damaging Het
Olfr993 AAGTCTGGAGTC AAGTC 2: 85,414,713 probably null Het
Pacs1 T C 19: 5,147,207 M430V probably benign Het
Piezo2 A G 18: 63,145,105 S243P probably damaging Het
Ppp1r36 A T 12: 76,428,078 probably null Het
Prdm16 T A 4: 154,346,144 probably null Het
Prss36 A T 7: 127,934,233 W97R probably damaging Het
Psmg4 A T 13: 34,178,064 I112F probably damaging Het
Ptpru C T 4: 131,772,557 G1259R probably damaging Het
Rsph4a T C 10: 33,909,341 I416T possibly damaging Het
Scn2a C T 2: 65,701,756 R571C probably damaging Het
Selenbp1 A G 3: 94,944,416 M423V probably benign Het
Serpina3i G A 12: 104,268,492 A361T possibly damaging Het
Serpinb3c A T 1: 107,271,704 D362E probably damaging Het
Sgcg A G 14: 61,236,855 V113A possibly damaging Het
Slc3a2 T C 19: 8,713,644 K74R probably damaging Het
Smco1 T A 16: 32,273,876 W122R probably damaging Het
Snx19 A G 9: 30,427,973 K136E possibly damaging Het
Trim32 A G 4: 65,614,388 N394S probably damaging Het
Uqcrb T C 13: 66,900,825 D87G probably damaging Het
Wipf3 T C 6: 54,485,323 S173P possibly damaging Het
Zfp473 T C 7: 44,732,638 E756G probably damaging Het
Other mutations in Sf3a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
IGL01623:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
PIT4495001:Sf3a3 UTSW 4 124728320 missense probably damaging 1.00
R0070:Sf3a3 UTSW 4 124714955 missense probably benign 0.04
R1441:Sf3a3 UTSW 4 124725142 missense probably damaging 0.99
R1858:Sf3a3 UTSW 4 124729495 missense probably damaging 1.00
R1928:Sf3a3 UTSW 4 124722093 missense possibly damaging 0.56
R1943:Sf3a3 UTSW 4 124715901 missense possibly damaging 0.95
R2101:Sf3a3 UTSW 4 124718343 missense possibly damaging 0.93
R2984:Sf3a3 UTSW 4 124718409 missense probably damaging 1.00
R3434:Sf3a3 UTSW 4 124725077 missense possibly damaging 0.95
R4366:Sf3a3 UTSW 4 124725139 missense probably benign
R4711:Sf3a3 UTSW 4 124728181 missense probably benign 0.01
R5032:Sf3a3 UTSW 4 124725166 missense probably benign 0.17
R5607:Sf3a3 UTSW 4 124714953 missense probably damaging 1.00
R5997:Sf3a3 UTSW 4 124722058 missense probably damaging 0.99
R6166:Sf3a3 UTSW 4 124723384 intron probably benign
R7030:Sf3a3 UTSW 4 124722880 missense probably damaging 1.00
R7038:Sf3a3 UTSW 4 124728426 missense probably benign 0.16
R7157:Sf3a3 UTSW 4 124722900 missense probably damaging 0.98
R7184:Sf3a3 UTSW 4 124714979 missense probably benign 0.10
R7250:Sf3a3 UTSW 4 124722915 missense probably benign 0.03
R9212:Sf3a3 UTSW 4 124728128 missense possibly damaging 0.67
Z1176:Sf3a3 UTSW 4 124714901 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTCTCACCTCAGGAACAGC -3'
(R):5'- TTCCCAAGAACAGTGGCTTTC -3'

Sequencing Primer
(F):5'- CGACAGCTCACTCATGAAAATGTTC -3'
(R):5'- AGAACAGTGGCTTTCAACTCCTTAC -3'
Posted On 2016-10-06