Incidental Mutation 'R5537:Pfkp'
ID434892
Institutional Source Beutler Lab
Gene Symbol Pfkp
Ensembl Gene ENSMUSG00000021196
Gene Namephosphofructokinase, platelet
Synonyms9330125N24Rik, 1200015H23Rik, PFK-C
MMRRC Submission 043095-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R5537 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location6579768-6648777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6619242 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 235 (W235L)
Ref Sequence ENSEMBL: ENSMUSP00000021614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021614] [ENSMUST00000136585] [ENSMUST00000138703]
Predicted Effect probably damaging
Transcript: ENSMUST00000021614
AA Change: W235L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021614
Gene: ENSMUSG00000021196
AA Change: W235L

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:PFK 25 332 4.7e-114 PFAM
Pfam:PFK 411 696 1.2e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135761
Predicted Effect probably benign
Transcript: ENSMUST00000136585
SMART Domains Protein: ENSMUSP00000115313
Gene: ENSMUSG00000021196

DomainStartEndE-ValueType
Pfam:PFK 1 167 1.1e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137327
Predicted Effect probably damaging
Transcript: ENSMUST00000138703
AA Change: W235L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117030
Gene: ENSMUSG00000021196
AA Change: W235L

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:PFK 24 334 6.7e-136 PFAM
Pfam:PFK 410 698 1.1e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151894
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphofructokinase A protein family. The encoded enzyme is the platelet-specific isoform of phosphofructokinase and plays a key role in glycolysis regulation. This gene may play a role in metabolic reprogramming in some cancers, including clear cell renal cell carcinomas, and cancer of the bladder, breast, and lung. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,955,485 I1123F probably damaging Het
Acsl3 C T 1: 78,706,356 R702C probably damaging Het
Ank1 A G 8: 23,114,876 E1031G probably damaging Het
Ankle2 T C 5: 110,249,495 S536P probably damaging Het
Arfgef2 G T 2: 166,856,593 probably null Het
Bahd1 G T 2: 118,915,980 D27Y probably damaging Het
Brinp2 C T 1: 158,255,013 V246I probably damaging Het
Ccdc187 C A 2: 26,276,225 A731S probably benign Het
Cdc37l1 T A 19: 28,995,118 N70K probably damaging Het
Cdk5r1 A G 11: 80,477,999 Y164C probably damaging Het
Clrn3 A T 7: 135,514,062 H186Q probably benign Het
Col12a1 G A 9: 79,699,590 T517I probably damaging Het
Crhr1 T A 11: 104,163,856 N98K possibly damaging Het
Dst C T 1: 34,189,878 S2362L probably benign Het
Eapp G A 12: 54,692,059 T98I probably benign Het
Gm8394 A G 10: 85,314,049 noncoding transcript Het
Iqsec3 T C 6: 121,412,644 probably benign Het
Kctd12 A G 14: 102,982,277 V55A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lgr5 T C 10: 115,456,689 D432G probably benign Het
Mrgprx1 T A 7: 48,021,150 H283L probably benign Het
Nlrp4e T C 7: 23,320,489 F134L probably benign Het
Olfr1030 T A 2: 85,984,226 Y129N possibly damaging Het
Olfr1307 A T 2: 111,945,048 M136K probably damaging Het
Olfr394 T C 11: 73,887,697 K225R probably benign Het
Olfr902 T A 9: 38,449,242 Y123* probably null Het
Prom1 C T 5: 44,000,776 probably null Het
Rab14 A T 2: 35,192,637 F12L possibly damaging Het
Rnf40 T A 7: 127,596,089 I429N probably benign Het
S100pbp G A 4: 129,182,188 P115S probably benign Het
Scarf1 G A 11: 75,525,531 A600T probably damaging Het
Slc6a5 T C 7: 49,959,311 F755L probably benign Het
Slc7a2 A T 8: 40,913,986 I510F probably benign Het
Spag16 T C 1: 69,827,016 S5P probably benign Het
Tex15 A G 8: 33,571,613 Y631C probably damaging Het
Tmem182 A T 1: 40,854,909 I195F probably benign Het
Tox A G 4: 6,697,510 L431P probably damaging Het
Tprn G A 2: 25,263,357 A224T probably benign Het
Tsg101 T C 7: 46,891,128 K294E probably benign Het
Tubb2a C A 13: 34,075,451 V119L probably benign Het
Vps37d C T 5: 135,074,402 E129K possibly damaging Het
Zfp974 TAATCTGTCTCCAAATCTG TAATCTG 7: 27,912,246 probably benign Het
Zpld1 A G 16: 55,233,640 V263A possibly damaging Het
Other mutations in Pfkp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Pfkp APN 13 6619550 missense probably damaging 1.00
IGL00983:Pfkp APN 13 6581567 missense probably damaging 1.00
IGL01099:Pfkp APN 13 6603390 splice site probably benign
IGL01825:Pfkp APN 13 6620978 missense probably damaging 1.00
IGL02164:Pfkp APN 13 6597915 missense probably damaging 1.00
IGL02331:Pfkp APN 13 6597960 missense probably benign 0.33
IGL02680:Pfkp APN 13 6600672 unclassified probably benign
IGL02852:Pfkp APN 13 6605023 missense possibly damaging 0.57
R0414:Pfkp UTSW 13 6593210 missense probably benign 0.03
R0542:Pfkp UTSW 13 6621992 nonsense probably null
R0612:Pfkp UTSW 13 6605634 critical splice donor site probably null
R0767:Pfkp UTSW 13 6605012 missense probably damaging 0.98
R1417:Pfkp UTSW 13 6605719 missense probably benign 0.00
R1534:Pfkp UTSW 13 6619538 missense probably damaging 1.00
R1612:Pfkp UTSW 13 6588589 missense probably damaging 1.00
R2278:Pfkp UTSW 13 6619209 unclassified probably null
R2919:Pfkp UTSW 13 6593243 missense probably damaging 0.98
R2996:Pfkp UTSW 13 6635930 missense probably benign 0.01
R4214:Pfkp UTSW 13 6619225 missense probably damaging 0.99
R4374:Pfkp UTSW 13 6620989 missense probably damaging 1.00
R4693:Pfkp UTSW 13 6600635 missense possibly damaging 0.91
R5534:Pfkp UTSW 13 6648583 missense probably damaging 1.00
R5619:Pfkp UTSW 13 6598729 unclassified probably benign
R5677:Pfkp UTSW 13 6588595 missense probably damaging 1.00
R6038:Pfkp UTSW 13 6597969 missense probably benign 0.14
R6038:Pfkp UTSW 13 6597969 missense probably benign 0.14
R6216:Pfkp UTSW 13 6619188 missense probably benign 0.00
R6330:Pfkp UTSW 13 6585250 unclassified probably benign
R6676:Pfkp UTSW 13 6586539 missense possibly damaging 0.74
R7044:Pfkp UTSW 13 6581567 missense probably damaging 1.00
R7146:Pfkp UTSW 13 6602781 missense probably benign 0.00
R7193:Pfkp UTSW 13 6593216 missense probably benign 0.00
R7588:Pfkp UTSW 13 6648637 missense possibly damaging 0.81
R7611:Pfkp UTSW 13 6605083 critical splice acceptor site probably null
R7821:Pfkp UTSW 13 6597872 missense probably damaging 1.00
Z1177:Pfkp UTSW 13 6619252 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CTACACTGGCAGATCCTTGC -3'
(R):5'- GCAGTCTCAAAGGACCCAGAAG -3'

Sequencing Primer
(F):5'- TGGCAGATCCTTGCCAACAG -3'
(R):5'- ACCCAGAAGAGCCCCTGTG -3'
Posted On2016-10-24