Incidental Mutation 'R5555:Irf5'
ID435331
Institutional Source Beutler Lab
Gene Symbol Irf5
Ensembl Gene ENSMUSG00000029771
Gene Nameinterferon regulatory factor 5
Synonymsmirf5
MMRRC Submission 043112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5555 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location29526625-29541871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29531146 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 4 (S4P)
Ref Sequence ENSEMBL: ENSMUSP00000127021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004392] [ENSMUST00000163511] [ENSMUST00000164626] [ENSMUST00000164922] [ENSMUST00000167252]
Predicted Effect probably benign
Transcript: ENSMUST00000004392
AA Change: S4P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004392
Gene: ENSMUSG00000029771
AA Change: S4P

DomainStartEndE-ValueType
IRF 10 123 6.39e-63 SMART
low complexity region 181 203 N/A INTRINSIC
IRF-3 246 430 1.67e-89 SMART
low complexity region 465 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163511
AA Change: S4P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127021
Gene: ENSMUSG00000029771
AA Change: S4P

DomainStartEndE-ValueType
IRF 10 123 6.39e-63 SMART
low complexity region 181 203 N/A INTRINSIC
IRF-3 246 430 1.67e-89 SMART
low complexity region 465 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164626
AA Change: S4P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130548
Gene: ENSMUSG00000029771
AA Change: S4P

DomainStartEndE-ValueType
IRF 10 80 9.78e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164922
SMART Domains Protein: ENSMUSP00000145299
Gene: ENSMUSG00000029771

DomainStartEndE-ValueType
IRF 1 86 7.7e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167252
AA Change: S4P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126273
Gene: ENSMUSG00000029771
AA Change: S4P

DomainStartEndE-ValueType
IRF 10 123 2.8e-65 SMART
low complexity region 181 203 N/A INTRINSIC
IRF-3 246 430 1.3e-93 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the interferon regulatory factor (IRF) family, a group of transcription factors with diverse roles, including virus-mediated activation of interferon, and modulation of cell growth, differentiation, apoptosis, and immune system activity. Members of the IRF family are characterized by a conserved N-terminal DNA-binding domain containing tryptophan (W) repeats. Alternative promoter use and alternative splicing result in multiple transcript variants, and a 30-nt indel polymorphism (SNP rs60344245) can result in loss of a 10-aa segment. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice exhibit resistance to lethal shock with a marked decrease in the serum levels of proinflammatory cytokines, but normal B cell development. Mice homozygous for another allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,422,296 probably null Het
Atg7 T C 6: 114,702,053 V366A probably damaging Het
Cadm2 A T 16: 66,784,815 V192E probably damaging Het
Chil6 C T 3: 106,389,952 S291N possibly damaging Het
D7Ertd443e T C 7: 134,349,591 T118A probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah1 T A 14: 31,290,819 T1837S probably damaging Het
Ext1 A G 15: 53,088,143 V515A probably damaging Het
Fer1l4 T C 2: 156,048,189 E272G probably damaging Het
Fras1 T A 5: 96,677,377 H1475Q probably benign Het
Grid1 T C 14: 35,520,705 S672P possibly damaging Het
Gtpbp4 A G 13: 8,979,427 probably null Het
Hsp90aa1 A T 12: 110,692,734 V543E probably damaging Het
Kif2b G T 11: 91,575,460 Q666K probably benign Het
Macc1 A T 12: 119,450,375 H762L probably benign Het
Map1s C T 8: 70,917,107 T941M probably damaging Het
Mrgprb1 T A 7: 48,447,775 I130F probably benign Het
Nbeal1 T G 1: 60,237,152 V684G possibly damaging Het
Ngly1 C T 14: 16,270,508 Q173* probably null Het
Plcb3 A T 19: 6,966,219 M104K probably benign Het
Plcg2 T A 8: 117,612,995 Y1048* probably null Het
Ptprf T C 4: 118,224,924 Y1039C probably damaging Het
Rab38 A G 7: 88,430,487 Y29C probably damaging Het
Rcan2 T A 17: 44,037,030 V210E probably damaging Het
Rptn A T 3: 93,396,701 Q447L probably benign Het
Scel G A 14: 103,602,206 R495K probably benign Het
Scn11a G T 9: 119,755,238 P1437Q probably damaging Het
Sim2 A G 16: 94,109,456 D239G probably damaging Het
Skap2 A G 6: 51,860,018 Y356H probably damaging Het
Skint11 A G 4: 114,194,601 T49A probably benign Het
Snx33 G A 9: 56,925,397 H463Y probably benign Het
Steap2 T C 5: 5,677,544 T264A possibly damaging Het
Stk40 T A 4: 126,135,059 V238E probably damaging Het
Sun2 T C 15: 79,734,127 D277G probably benign Het
Ttll9 T C 2: 152,990,100 probably null Het
Vmn1r54 G A 6: 90,269,365 C87Y probably benign Het
Other mutations in Irf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Irf5 APN 6 29536103 missense probably damaging 1.00
IGL02405:Irf5 APN 6 29535761 missense probably damaging 0.99
IGL02953:Irf5 APN 6 29536672 missense possibly damaging 0.76
R0099:Irf5 UTSW 6 29533967 missense probably damaging 0.98
R0116:Irf5 UTSW 6 29536109 missense probably damaging 1.00
R0482:Irf5 UTSW 6 29535370 missense probably benign 0.00
R1827:Irf5 UTSW 6 29536673 missense possibly damaging 0.67
R1938:Irf5 UTSW 6 29536739 missense probably benign 0.05
R3969:Irf5 UTSW 6 29536782 missense probably benign 0.00
R4408:Irf5 UTSW 6 29534001 unclassified probably null
R4447:Irf5 UTSW 6 29535942 missense probably damaging 1.00
R4828:Irf5 UTSW 6 29531141 missense probably damaging 0.99
R5891:Irf5 UTSW 6 29529425 intron probably benign
R6148:Irf5 UTSW 6 29535959 missense probably damaging 1.00
R7084:Irf5 UTSW 6 29535877 missense probably damaging 0.98
R7274:Irf5 UTSW 6 29534040 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCACGGGAGTTTCCTTCTC -3'
(R):5'- CTTACCTTGAAGATGGTGTTGTCCC -3'

Sequencing Primer
(F):5'- AGAACTCACAGGCTGCGC -3'
(R):5'- GAAGATGGTGTTGTCCCCATCC -3'
Posted On2016-10-24