Incidental Mutation 'R5547:C1qtnf2'
ID436356
Institutional Source Beutler Lab
Gene Symbol C1qtnf2
Ensembl Gene ENSMUSG00000046491
Gene NameC1q and tumor necrosis factor related protein 2
Synonyms1810033K05Rik, CTRP2
MMRRC Submission 043105-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5547 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location43474276-43491525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43490967 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 202 (E202G)
Ref Sequence ENSEMBL: ENSMUSP00000134705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057679] [ENSMUST00000151912] [ENSMUST00000173002]
Predicted Effect probably damaging
Transcript: ENSMUST00000057679
AA Change: E172G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051652
Gene: ENSMUSG00000046491
AA Change: E172G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Collagen 46 104 1.2e-10 PFAM
Pfam:Collagen 90 151 2.1e-11 PFAM
C1Q 152 287 3.96e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151912
SMART Domains Protein: ENSMUSP00000133616
Gene: ENSMUSG00000046491

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Collagen 46 103 6.8e-11 PFAM
Pfam:Collagen 79 137 3.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173002
AA Change: E202G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134705
Gene: ENSMUSG00000046491
AA Change: E202G

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
Pfam:Collagen 76 135 7.4e-11 PFAM
Pfam:Collagen 121 181 1.9e-11 PFAM
C1Q 182 317 3.96e-46 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A G 18: 56,528,284 S492P probably damaging Het
Arfgef1 A T 1: 10,160,976 D1133E probably damaging Het
Avpi1 T C 19: 42,124,943 K25R probably damaging Het
Bank1 T C 3: 136,066,349 S708G probably damaging Het
C6 T A 15: 4,808,488 V860E probably benign Het
Cbr1 T A 16: 93,609,810 V138E probably damaging Het
Cdip1 A G 16: 4,770,124 S2P probably damaging Het
Cep126 T C 9: 8,100,427 N702S probably damaging Het
Chek1 T C 9: 36,712,104 I381V probably benign Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cryz C T 3: 154,611,557 R138* probably null Het
Ctsll3 T A 13: 60,800,737 M103L probably benign Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Daxx CGATGATGATGA CGA 17: 33,912,659 probably benign Het
Dsg1a T G 18: 20,336,040 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Flt1 T A 5: 147,655,138 S505C probably damaging Het
Gm11127 G A 17: 36,057,904 H95Y possibly damaging Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hmcn1 A G 1: 150,737,506 V1390A possibly damaging Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Klhl3 C T 13: 58,102,429 probably null Het
Lekr1 T A 3: 65,669,180 probably null Het
Lhx5 A G 5: 120,434,610 Q98R probably benign Het
Nuggc A G 14: 65,641,881 K681E possibly damaging Het
Numa1 G T 7: 102,013,930 A735S probably damaging Het
Olfr201 G A 16: 59,269,116 L184F probably benign Het
Oog3 A T 4: 144,158,028 L446Q probably benign Het
Otogl C T 10: 107,782,048 E1735K possibly damaging Het
Pcsk5 T C 19: 17,752,124 D119G probably benign Het
Pgpep1 T C 8: 70,652,419 K64E probably benign Het
Prr19 A C 7: 25,303,963 D334A probably damaging Het
Ptprh G T 7: 4,554,222 S691* probably null Het
Recql4 G A 15: 76,705,794 R684* probably null Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rnf40 T C 7: 127,589,130 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tdo2 T C 3: 81,958,940 R339G probably damaging Het
Tmem245 C T 4: 56,910,156 probably null Het
Trim24 A G 6: 37,965,550 E965G probably damaging Het
Trmt112 T C 19: 6,910,788 S103P probably damaging Het
Trpv6 A T 6: 41,636,154 V26D possibly damaging Het
Zfp850 A G 7: 27,989,419 C455R probably damaging Het
Zfp946 T C 17: 22,454,892 I209T probably benign Het
Zfp957 T C 14: 79,213,966 N131S probably benign Het
Other mutations in C1qtnf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00266:C1qtnf2 APN 11 43485999 missense possibly damaging 0.93
IGL03178:C1qtnf2 APN 11 43490989 missense probably damaging 0.98
PIT4305001:C1qtnf2 UTSW 11 43491195 missense probably damaging 1.00
R0226:C1qtnf2 UTSW 11 43490843 missense probably benign
R1412:C1qtnf2 UTSW 11 43491132 missense probably damaging 1.00
R1796:C1qtnf2 UTSW 11 43491287 missense probably damaging 1.00
R2145:C1qtnf2 UTSW 11 43490984 missense probably damaging 1.00
R2504:C1qtnf2 UTSW 11 43491156 missense probably damaging 1.00
R3829:C1qtnf2 UTSW 11 43491321 missense probably benign
R5106:C1qtnf2 UTSW 11 43486053 missense possibly damaging 0.71
R5879:C1qtnf2 UTSW 11 43486008 missense probably damaging 0.99
R8138:C1qtnf2 UTSW 11 43486011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGTGTTCCAGGTCCAC -3'
(R):5'- GGCATCAAAAGTCCGAATGC -3'

Sequencing Primer
(F):5'- GCAAAGCTGGGGCCATTG -3'
(R):5'- AGTAATAGATCCCCGGCA -3'
Posted On2016-10-24