Incidental Mutation 'R5547:Clock'
ID436340
Institutional Source Beutler Lab
Gene Symbol Clock
Ensembl Gene ENSMUSG00000029238
Gene Namecircadian locomotor output cycles kaput
Synonyms5330400M04Rik, bHLHe8, KAT13D
MMRRC Submission 043105-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R5547 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location76209868-76304792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76230338 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 572 (P572S)
Ref Sequence ENSEMBL: ENSMUSP00000144022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075159] [ENSMUST00000202122] [ENSMUST00000202651]
Predicted Effect probably benign
Transcript: ENSMUST00000075159
AA Change: P572S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238
AA Change: P572S

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201768
Predicted Effect probably benign
Transcript: ENSMUST00000202122
AA Change: P572S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238
AA Change: P572S

DomainStartEndE-ValueType
TFS2N 34 106 4.1e-3 SMART
HLH 40 90 3.4e-14 SMART
PAS 109 175 9.6e-9 SMART
PAS 264 330 1.8e-6 SMART
PAC 336 379 3.9e-9 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 737 795 N/A INTRINSIC
low complexity region 817 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202651
AA Change: P572S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238
AA Change: P572S

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202857
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A G 18: 56,528,284 S492P probably damaging Het
Arfgef1 A T 1: 10,160,976 D1133E probably damaging Het
Avpi1 T C 19: 42,124,943 K25R probably damaging Het
Bank1 T C 3: 136,066,349 S708G probably damaging Het
C1qtnf2 A G 11: 43,490,967 E202G probably damaging Het
C6 T A 15: 4,808,488 V860E probably benign Het
Cbr1 T A 16: 93,609,810 V138E probably damaging Het
Cdip1 A G 16: 4,770,124 S2P probably damaging Het
Cep126 T C 9: 8,100,427 N702S probably damaging Het
Chek1 T C 9: 36,712,104 I381V probably benign Het
Cryz C T 3: 154,611,557 R138* probably null Het
Ctsll3 T A 13: 60,800,737 M103L probably benign Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Daxx CGATGATGATGA CGA 17: 33,912,659 probably benign Het
Dsg1a T G 18: 20,336,040 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Flt1 T A 5: 147,655,138 S505C probably damaging Het
Gm11127 G A 17: 36,057,904 H95Y possibly damaging Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hmcn1 A G 1: 150,737,506 V1390A possibly damaging Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Klhl3 C T 13: 58,102,429 probably null Het
Lekr1 T A 3: 65,669,180 probably null Het
Lhx5 A G 5: 120,434,610 Q98R probably benign Het
Nuggc A G 14: 65,641,881 K681E possibly damaging Het
Numa1 G T 7: 102,013,930 A735S probably damaging Het
Olfr201 G A 16: 59,269,116 L184F probably benign Het
Oog3 A T 4: 144,158,028 L446Q probably benign Het
Otogl C T 10: 107,782,048 E1735K possibly damaging Het
Pcsk5 T C 19: 17,752,124 D119G probably benign Het
Pgpep1 T C 8: 70,652,419 K64E probably benign Het
Prr19 A C 7: 25,303,963 D334A probably damaging Het
Ptprh G T 7: 4,554,222 S691* probably null Het
Recql4 G A 15: 76,705,794 R684* probably null Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rnf40 T C 7: 127,589,130 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tdo2 T C 3: 81,958,940 R339G probably damaging Het
Tmem245 C T 4: 56,910,156 probably null Het
Trim24 A G 6: 37,965,550 E965G probably damaging Het
Trmt112 T C 19: 6,910,788 S103P probably damaging Het
Trpv6 A T 6: 41,636,154 V26D possibly damaging Het
Zfp850 A G 7: 27,989,419 C455R probably damaging Het
Zfp946 T C 17: 22,454,892 I209T probably benign Het
Zfp957 T C 14: 79,213,966 N131S probably benign Het
Other mutations in Clock
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Clock APN 5 76229464 missense probably benign 0.17
IGL00725:Clock APN 5 76254413 nonsense probably null
IGL01304:Clock APN 5 76266355 critical splice donor site probably null
IGL01369:Clock APN 5 76237086 missense probably benign 0.30
IGL01542:Clock APN 5 76231475 missense possibly damaging 0.82
IGL02541:Clock APN 5 76262672 splice site probably null
IGL02602:Clock APN 5 76254426 missense probably null 1.00
IGL02602:Clock APN 5 76254427 missense probably damaging 1.00
IGL03186:Clock APN 5 76243082 missense probably damaging 0.98
IGL03309:Clock APN 5 76231394 critical splice donor site probably null
R6760_Clock_188 UTSW 5 76226976 missense unknown
uhr UTSW 5 76229554 nonsense probably null
R0304:Clock UTSW 5 76226985 missense unknown
R0593:Clock UTSW 5 76265836 missense probably benign 0.25
R0654:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0684:Clock UTSW 5 76245518 missense probably damaging 0.96
R0707:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0751:Clock UTSW 5 76229361 missense possibly damaging 0.75
R0865:Clock UTSW 5 76266424 splice site probably benign
R0920:Clock UTSW 5 76230320 missense possibly damaging 0.80
R1396:Clock UTSW 5 76266802 missense probably benign 0.00
R1450:Clock UTSW 5 76262731 nonsense probably null
R1487:Clock UTSW 5 76266354 splice site probably null
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1858:Clock UTSW 5 76240909 missense possibly damaging 0.92
R1872:Clock UTSW 5 76248462 missense possibly damaging 0.67
R1905:Clock UTSW 5 76266888 splice site probably benign
R1937:Clock UTSW 5 76229493 missense probably damaging 0.99
R2411:Clock UTSW 5 76231513 missense probably benign 0.08
R2887:Clock UTSW 5 76245273 missense probably damaging 0.99
R3410:Clock UTSW 5 76229554 nonsense probably null
R4514:Clock UTSW 5 76230199 missense probably benign 0.00
R4598:Clock UTSW 5 76235810 missense probably benign 0.00
R4599:Clock UTSW 5 76235810 missense probably benign 0.00
R4795:Clock UTSW 5 76265916 missense probably damaging 1.00
R4796:Clock UTSW 5 76265916 missense probably damaging 1.00
R4973:Clock UTSW 5 76254411 missense possibly damaging 0.62
R5204:Clock UTSW 5 76243170 splice site probably null
R5271:Clock UTSW 5 76241954 missense probably damaging 1.00
R5630:Clock UTSW 5 76230338 missense probably benign 0.02
R5631:Clock UTSW 5 76230338 missense probably benign 0.02
R5632:Clock UTSW 5 76230338 missense probably benign 0.02
R5787:Clock UTSW 5 76237051 missense probably damaging 1.00
R6274:Clock UTSW 5 76237153 missense probably benign 0.45
R6578:Clock UTSW 5 76216709 missense unknown
R6622:Clock UTSW 5 76241954 missense probably damaging 1.00
R6760:Clock UTSW 5 76226976 missense unknown
R6793:Clock UTSW 5 76237120 frame shift probably null
R7406:Clock UTSW 5 76266845 start codon destroyed probably null 0.26
R7414:Clock UTSW 5 76262764 missense probably benign 0.00
R7560:Clock UTSW 5 76242891 splice site probably null
R7593:Clock UTSW 5 76236298 missense possibly damaging 0.80
R7640:Clock UTSW 5 76248378 missense possibly damaging 0.71
R7708:Clock UTSW 5 76266409 missense probably benign 0.00
R7713:Clock UTSW 5 76245420 critical splice donor site probably null
R7807:Clock UTSW 5 76243135 missense probably benign 0.01
R8171:Clock UTSW 5 76266414 missense possibly damaging 0.94
R8190:Clock UTSW 5 76227204 missense probably damaging 0.98
R8225:Clock UTSW 5 76241912 missense probably damaging 0.99
R8309:Clock UTSW 5 76254422 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATAAAGGCTGGTACAACACAGC -3'
(R):5'- CGGGGTTCAGAAGATAACTTTTGAG -3'

Sequencing Primer
(F):5'- TCAATTACCTGAGTTGATGTACTTTG -3'
(R):5'- CAGGCTGTCAGACTTATG -3'
Posted On2016-10-24