Incidental Mutation 'R5589:Vmn1r215'
ID437373
Institutional Source Beutler Lab
Gene Symbol Vmn1r215
Ensembl Gene ENSMUSG00000099917
Gene Namevomeronasal 1 receptor 215
SynonymsV1ri2
MMRRC Submission 043142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5589 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23068025-23078006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23076020 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 77 (G77C)
Ref Sequence ENSEMBL: ENSMUSP00000154763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072972] [ENSMUST00000228092]
Predicted Effect probably damaging
Transcript: ENSMUST00000072972
AA Change: G77C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072739
Gene: ENSMUSG00000099917
AA Change: G77C

DomainStartEndE-ValueType
Pfam:V1R 35 298 2.4e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228092
AA Change: G77C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,518,066 M76L probably benign Het
Alg1 T A 16: 5,235,222 W116R probably benign Het
Ano3 A T 2: 110,884,995 S33T probably damaging Het
Atp2b2 T C 6: 113,774,439 E556G possibly damaging Het
BC067074 A G 13: 113,317,950 R177G possibly damaging Het
Brca2 T A 5: 150,557,132 I2761K possibly damaging Het
Ccdc68 G A 18: 69,946,506 G141E probably benign Het
Cckbr T C 7: 105,434,525 V220A probably damaging Het
Ccnd3 G A 17: 47,598,619 R45Q probably damaging Het
Cdh24 G T 14: 54,637,375 T391N probably damaging Het
Cldn11 A G 3: 31,150,246 T33A probably damaging Het
Clec2e T A 6: 129,098,428 Y50F probably benign Het
Cntnap1 A G 11: 101,185,118 N943D probably benign Het
Dmgdh T C 13: 93,677,157 V70A probably damaging Het
Gm14496 C A 2: 181,995,881 Y249* probably null Het
Gm9774 T A 3: 92,428,805 probably benign Het
Gmnc T A 16: 26,962,964 H105L probably damaging Het
Gpt2 A G 8: 85,493,111 Y62C probably damaging Het
Ift80 T C 3: 68,930,900 R413G probably damaging Het
Kctd16 C A 18: 40,259,008 D216E probably damaging Het
Kif26b T C 1: 178,916,299 V873A probably benign Het
Klra4 G T 6: 130,062,154 Q92K probably benign Het
L1td1 C A 4: 98,738,104 N845K possibly damaging Het
Lama3 C T 18: 12,472,220 T1077I possibly damaging Het
Loxhd1 T C 18: 77,342,055 I230T possibly damaging Het
Lsg1 T C 16: 30,581,001 N160S probably damaging Het
Lyzl4 G A 9: 121,584,403 R24C probably damaging Het
Mib1 A G 18: 10,794,488 N658S probably benign Het
Mmp8 T C 9: 7,566,274 I377T probably damaging Het
Mtmr14 T C 6: 113,261,282 probably null Het
Myo1c A G 11: 75,657,588 T58A possibly damaging Het
Myo9a C T 9: 59,895,244 Q2005* probably null Het
Neu3 G T 7: 99,823,429 P34T probably benign Het
Nlrp4b G A 7: 10,715,585 V205I probably benign Het
Olfr1095 A G 2: 86,850,774 I308T unknown Het
Olfr1154 T C 2: 87,903,347 T110A probably benign Het
Olfr1272 C T 2: 90,281,969 G202D probably damaging Het
Olfr1282 T C 2: 111,335,505 N191S possibly damaging Het
Olfr191 A T 16: 59,085,971 S171T probably benign Het
Olfr798 T G 10: 129,625,450 T204P probably damaging Het
Pcsk6 T C 7: 65,929,185 probably null Het
Pik3c2a A G 7: 116,417,658 V288A probably benign Het
Plcd3 T C 11: 103,077,803 D354G probably benign Het
Prkdc C A 16: 15,706,791 N1219K probably benign Het
Prl3d1 T A 13: 27,094,944 Y41N probably damaging Het
Qrich2 C T 11: 116,441,408 G2321R probably damaging Het
Rrbp1 T C 2: 143,989,966 I94V probably benign Het
Serinc1 C A 10: 57,523,166 V214L probably benign Het
Serpina9 G T 12: 104,001,469 N222K probably benign Het
Smchd1 A G 17: 71,440,961 Y429H probably damaging Het
Smyd1 C T 6: 71,262,180 V9M probably damaging Het
Sostdc1 C T 12: 36,317,247 Q141* probably null Het
Spam1 C T 6: 24,796,110 T20I probably benign Het
Tex47 T C 5: 7,304,834 V5A probably benign Het
Thbs4 T C 13: 92,776,074 probably null Het
Trim45 C T 3: 100,929,941 P531L probably damaging Het
Tshb A T 3: 102,778,162 Y50* probably null Het
Ttn T C 2: 76,768,976 I19230V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba6 G A 5: 86,122,429 T832I probably damaging Het
Unc13d A T 11: 116,069,753 V497D probably damaging Het
Usp13 T C 3: 32,837,858 V62A probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zbtb40 T C 4: 136,995,283 D828G probably damaging Het
Zfp74 A T 7: 29,934,565 C573S probably damaging Het
Other mutations in Vmn1r215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Vmn1r215 APN 13 23076249 missense probably damaging 0.98
IGL02515:Vmn1r215 APN 13 23075820 missense probably benign 0.21
IGL03061:Vmn1r215 APN 13 23075918 missense probably damaging 0.97
PIT4651001:Vmn1r215 UTSW 13 23076360 missense probably damaging 0.97
R0196:Vmn1r215 UTSW 13 23076084 missense probably damaging 1.00
R0816:Vmn1r215 UTSW 13 23075954 missense probably benign 0.00
R0817:Vmn1r215 UTSW 13 23075954 missense probably benign 0.00
R0820:Vmn1r215 UTSW 13 23075954 missense probably benign 0.00
R1104:Vmn1r215 UTSW 13 23076588 missense possibly damaging 0.50
R1733:Vmn1r215 UTSW 13 23076678 missense probably benign 0.43
R1912:Vmn1r215 UTSW 13 23076503 missense possibly damaging 0.94
R2010:Vmn1r215 UTSW 13 23076208 missense probably damaging 1.00
R2510:Vmn1r215 UTSW 13 23076173 missense probably benign 0.00
R2511:Vmn1r215 UTSW 13 23076173 missense probably benign 0.00
R2877:Vmn1r215 UTSW 13 23076561 missense probably benign 0.01
R3429:Vmn1r215 UTSW 13 23076208 missense probably damaging 1.00
R3854:Vmn1r215 UTSW 13 23075888 missense probably benign
R4124:Vmn1r215 UTSW 13 23075993 missense probably benign 0.42
R4235:Vmn1r215 UTSW 13 23075931 missense probably benign 0.31
R4979:Vmn1r215 UTSW 13 23075894 missense probably benign 0.04
R4991:Vmn1r215 UTSW 13 23076527 missense probably damaging 1.00
R5011:Vmn1r215 UTSW 13 23076551 missense probably damaging 1.00
R5026:Vmn1r215 UTSW 13 23076279 missense probably benign 0.30
R5070:Vmn1r215 UTSW 13 23076496 missense probably benign 0.03
R5589:Vmn1r215 UTSW 13 23076019 missense probably damaging 1.00
R5651:Vmn1r215 UTSW 13 23075811 missense possibly damaging 0.93
R5928:Vmn1r215 UTSW 13 23076317 missense possibly damaging 0.50
R6176:Vmn1r215 UTSW 13 23076358 missense probably damaging 1.00
R6228:Vmn1r215 UTSW 13 23076463 missense probably benign 0.19
R7270:Vmn1r215 UTSW 13 23075919 missense possibly damaging 0.77
R7313:Vmn1r215 UTSW 13 23076314 missense probably benign 0.01
R7820:Vmn1r215 UTSW 13 23076545 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGACCTGGAATTGTGGG -3'
(R):5'- CCTTTGATGTAGGAGAGCAAGTTG -3'

Sequencing Primer
(F):5'- CCTGGAATTGTGGGAAATATGC -3'
(R):5'- GCAAGTTGGAGCTTATGAGACC -3'
Posted On2016-10-26