Incidental Mutation 'R5645:Iqcc'
ID441050
Institutional Source Beutler Lab
Gene Symbol Iqcc
Ensembl Gene ENSMUSG00000040795
Gene NameIQ motif containing C
Synonyms
MMRRC Submission 043293-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5645 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129615126-129619099 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129616527 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 398 (H398Q)
Ref Sequence ENSEMBL: ENSMUSP00000040584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030586] [ENSMUST00000046675] [ENSMUST00000106035] [ENSMUST00000106037] [ENSMUST00000121442] [ENSMUST00000137090] [ENSMUST00000150357] [ENSMUST00000151838] [ENSMUST00000174073] [ENSMUST00000179209]
Predicted Effect probably benign
Transcript: ENSMUST00000030586
SMART Domains Protein: ENSMUSP00000030586
Gene: ENSMUSG00000028795

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 85 185 4.3e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000046675
AA Change: H398Q

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040584
Gene: ENSMUSG00000040795
AA Change: H398Q

DomainStartEndE-ValueType
IQ 5 27 6.6e-2 SMART
low complexity region 150 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106035
SMART Domains Protein: ENSMUSP00000101652
Gene: ENSMUSG00000028795

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 86 178 2.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106037
SMART Domains Protein: ENSMUSP00000101653
Gene: ENSMUSG00000078552

DomainStartEndE-ValueType
DCX 1 85 7.69e-26 SMART
DCX 118 205 6.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121442
SMART Domains Protein: ENSMUSP00000113036
Gene: ENSMUSG00000040795

DomainStartEndE-ValueType
IQ 5 27 6.6e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131559
Predicted Effect probably benign
Transcript: ENSMUST00000137090
SMART Domains Protein: ENSMUSP00000117568
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146378
Predicted Effect probably benign
Transcript: ENSMUST00000150357
SMART Domains Protein: ENSMUSP00000118241
Gene: ENSMUSG00000028795

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 85 104 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151838
SMART Domains Protein: ENSMUSP00000122229
Gene: ENSMUSG00000028795

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 85 120 1.1e-13 PFAM
low complexity region 132 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174073
SMART Domains Protein: ENSMUSP00000133325
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179209
SMART Domains Protein: ENSMUSP00000135913
Gene: ENSMUSG00000078552

DomainStartEndE-ValueType
DCX 1 86 1.32e-24 SMART
DCX 91 178 1.1e-12 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,204 I169V probably damaging Het
2310007B03Rik T C 1: 93,152,946 T413A probably damaging Het
4930503B20Rik C T 3: 146,650,509 E215K probably damaging Het
5830411N06Rik G A 7: 140,248,940 V171I possibly damaging Het
Abca6 T C 11: 110,250,408 E29G probably damaging Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts12 A G 15: 11,277,420 T707A possibly damaging Het
Adcy2 C A 13: 68,729,202 probably null Het
Agbl4 A T 4: 111,657,330 I513F possibly damaging Het
Ak5 A T 3: 152,656,033 M84K possibly damaging Het
Akap1 T C 11: 88,845,627 T103A probably benign Het
Akap9 A G 5: 4,050,590 T2751A probably benign Het
Amer3 A T 1: 34,588,381 H567L possibly damaging Het
Ano6 A G 15: 95,920,351 Y325C probably benign Het
Apba2 A G 7: 64,695,806 E248G possibly damaging Het
Asap2 T A 12: 21,265,982 V967E probably damaging Het
Boc A G 16: 44,499,661 V320A probably damaging Het
Car13 T A 3: 14,645,120 Y41N possibly damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cep295 A T 9: 15,332,794 H1455Q probably damaging Het
Cep295 C A 9: 15,335,108 S684I possibly damaging Het
Cr2 G T 1: 195,154,273 H861N probably damaging Het
Cul5 T C 9: 53,622,943 I630V probably benign Het
Cyp2c37 G A 19: 39,994,152 V145I probably benign Het
Dnmt1 G A 9: 20,922,147 T500M probably damaging Het
Fam161a T A 11: 23,015,725 I6N probably damaging Het
Fam214a T A 9: 75,025,679 V976E probably damaging Het
Fry T C 5: 150,380,867 V574A probably damaging Het
Glb1l3 G T 9: 26,824,826 L553I probably benign Het
Gm1123 T C 9: 99,014,191 D212G probably benign Het
Grin2a T A 16: 9,992,226 D103V probably damaging Het
Heg1 A G 16: 33,706,963 I98V probably benign Het
Hmcn2 C A 2: 31,420,812 T3356N possibly damaging Het
Hpf1 T G 8: 60,896,800 I154S possibly damaging Het
Ifnar2 A G 16: 91,404,227 D452G possibly damaging Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Iqgap3 T C 3: 88,117,699 I669T probably damaging Het
Itgae A G 11: 73,129,248 T859A probably damaging Het
Kansl1l T C 1: 66,801,344 M266V probably benign Het
Kbtbd3 A G 9: 4,331,426 D600G possibly damaging Het
Klf13 G A 7: 63,891,600 probably benign Het
Kmt2d A G 15: 98,844,397 probably benign Het
Lama1 A G 17: 67,802,948 D2188G probably damaging Het
Leng8 A G 7: 4,145,274 T682A probably damaging Het
Mslnl G T 17: 25,737,842 G34V possibly damaging Het
Mycbp2 A T 14: 103,188,608 S2360R probably damaging Het
Mycbp2 C A 14: 103,188,615 probably null Het
Nkx2-2 T C 2: 147,184,399 T140A probably damaging Het
Olfr1233 A T 2: 89,339,705 V199E possibly damaging Het
Olfr745 T C 14: 50,643,067 V262A probably benign Het
Oser1 C T 2: 163,407,045 R79H probably damaging Het
Pfas A G 11: 68,991,132 V909A probably damaging Het
Pkhd1l1 A G 15: 44,532,992 E1970G probably benign Het
Prph2 G T 17: 46,910,667 probably benign Het
Rusc2 G T 4: 43,425,758 A1288S probably benign Het
Sdha A G 13: 74,323,839 probably null Het
Sec16a T G 2: 26,439,895 T703P probably benign Het
Senp7 T A 16: 56,173,208 N724K possibly damaging Het
Skint1 A G 4: 112,025,502 I248V probably benign Het
Slc9a5 T C 8: 105,357,013 V395A probably benign Het
Slco1a4 T C 6: 141,834,659 N135S possibly damaging Het
Sncaip A G 18: 52,894,956 I412M probably damaging Het
Tacc2 A T 7: 130,624,051 D841V possibly damaging Het
Tekt1 A T 11: 72,351,837 H281Q probably benign Het
Tex46 G T 4: 136,612,917 M104I probably benign Het
Tjp3 T C 10: 81,278,620 probably null Het
Treh A G 9: 44,682,678 Y154C probably damaging Het
Trim80 T A 11: 115,446,785 L428Q probably damaging Het
Trpm6 A G 19: 18,853,604 K1278E probably damaging Het
Usp34 T C 11: 23,375,024 M990T possibly damaging Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Ywhae T C 11: 75,756,924 M160T probably benign Het
Zcchc11 G A 4: 108,557,373 R49H probably damaging Het
Other mutations in Iqcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01991:Iqcc APN 4 129617789 missense probably benign 0.08
IGL02134:Iqcc APN 4 129619025 missense probably damaging 1.00
IGL02420:Iqcc APN 4 129616955 missense probably benign 0.00
FR4976:Iqcc UTSW 4 129616676 unclassified probably benign
R0131:Iqcc UTSW 4 129616599 missense probably damaging 1.00
R0131:Iqcc UTSW 4 129616599 missense probably damaging 1.00
R0132:Iqcc UTSW 4 129616599 missense probably damaging 1.00
R1520:Iqcc UTSW 4 129616969 missense possibly damaging 0.90
R5043:Iqcc UTSW 4 129618277 unclassified probably benign
R5389:Iqcc UTSW 4 129618620 missense probably benign 0.32
R6242:Iqcc UTSW 4 129616846 missense probably damaging 0.99
R7335:Iqcc UTSW 4 129616708 missense not run
Predicted Primers PCR Primer
(F):5'- GCATCTGCTTTTGGGAACCC -3'
(R):5'- CCTTGTTCTAGAAAGGCTGAAAC -3'

Sequencing Primer
(F):5'- GAACCCTTCCTCTCCTGGATC -3'
(R):5'- AGCTGCCCACTCTCTCTGAAAATC -3'
Posted On2016-11-08