Incidental Mutation 'R5645:Fam161a'
ID441080
Institutional Source Beutler Lab
Gene Symbol Fam161a
Ensembl Gene ENSMUSG00000049811
Gene Namefamily with sequence similarity 161, member A
Synonyms4930430E16Rik
MMRRC Submission 043293-MU
Accession Numbers

Genbank: NM_028672; MGI: 1921123

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5645 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location23007531-23030788 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23015725 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 6 (I6N)
Ref Sequence ENSEMBL: ENSMUSP00000133293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058269] [ENSMUST00000109557] [ENSMUST00000151877] [ENSMUST00000172602] [ENSMUST00000173923]
Predicted Effect probably damaging
Transcript: ENSMUST00000058269
AA Change: I6N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063091
Gene: ENSMUSG00000049811
AA Change: I6N

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 401 4.7e-74 PFAM
Pfam:UPF0564 398 451 5.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094363
SMART Domains Protein: ENSMUSP00000091923
Gene: ENSMUSG00000049811

DomainStartEndE-ValueType
Pfam:UPF0564 1 136 3.6e-15 PFAM
low complexity region 181 202 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109557
AA Change: I6N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105184
Gene: ENSMUSG00000049811
AA Change: I6N

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 350 8.1e-36 PFAM
low complexity region 396 417 N/A INTRINSIC
coiled coil region 437 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151877
SMART Domains Protein: ENSMUSP00000121167
Gene: ENSMUSG00000049811

DomainStartEndE-ValueType
Pfam:UPF0564 1 263 2.2e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172602
AA Change: I6N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134485
Gene: ENSMUSG00000049811
AA Change: I6N

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 401 4.7e-74 PFAM
Pfam:UPF0564 398 451 5.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173923
AA Change: I6N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133293
Gene: ENSMUSG00000049811
AA Change: I6N

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208732
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the FAM161 family. It is expressed mainly in the retina. Mouse studies suggested that this gene is involved in development of retinal progenitors during embryogenesis, and that its activity is restricted to mature photoreceptors after birth. Mutations in this gene cause autosomal recessive retinitis pigmentosa-28. Alternatively spliced transcript variants have been identified.[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show early loss of visual function associated with alterations in photoreceptor ciliary structure, abnormal photoreceptor outer segment morphology, microgliosis, and progressive retinal photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,204 I169V probably damaging Het
2310007B03Rik T C 1: 93,152,946 T413A probably damaging Het
4930503B20Rik C T 3: 146,650,509 E215K probably damaging Het
5830411N06Rik G A 7: 140,248,940 V171I possibly damaging Het
Abca6 T C 11: 110,250,408 E29G probably damaging Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts12 A G 15: 11,277,420 T707A possibly damaging Het
Adcy2 C A 13: 68,729,202 probably null Het
Agbl4 A T 4: 111,657,330 I513F possibly damaging Het
Ak5 A T 3: 152,656,033 M84K possibly damaging Het
Akap1 T C 11: 88,845,627 T103A probably benign Het
Akap9 A G 5: 4,050,590 T2751A probably benign Het
Amer3 A T 1: 34,588,381 H567L possibly damaging Het
Ano6 A G 15: 95,920,351 Y325C probably benign Het
Apba2 A G 7: 64,695,806 E248G possibly damaging Het
Asap2 T A 12: 21,265,982 V967E probably damaging Het
Boc A G 16: 44,499,661 V320A probably damaging Het
Car13 T A 3: 14,645,120 Y41N possibly damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cep295 A T 9: 15,332,794 H1455Q probably damaging Het
Cep295 C A 9: 15,335,108 S684I possibly damaging Het
Cr2 G T 1: 195,154,273 H861N probably damaging Het
Cul5 T C 9: 53,622,943 I630V probably benign Het
Cyp2c37 G A 19: 39,994,152 V145I probably benign Het
Dnmt1 G A 9: 20,922,147 T500M probably damaging Het
Fam214a T A 9: 75,025,679 V976E probably damaging Het
Fry T C 5: 150,380,867 V574A probably damaging Het
Glb1l3 G T 9: 26,824,826 L553I probably benign Het
Gm1123 T C 9: 99,014,191 D212G probably benign Het
Grin2a T A 16: 9,992,226 D103V probably damaging Het
Heg1 A G 16: 33,706,963 I98V probably benign Het
Hmcn2 C A 2: 31,420,812 T3356N possibly damaging Het
Hpf1 T G 8: 60,896,800 I154S possibly damaging Het
Ifnar2 A G 16: 91,404,227 D452G possibly damaging Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Iqcc A T 4: 129,616,527 H398Q possibly damaging Het
Iqgap3 T C 3: 88,117,699 I669T probably damaging Het
Itgae A G 11: 73,129,248 T859A probably damaging Het
Kansl1l T C 1: 66,801,344 M266V probably benign Het
Kbtbd3 A G 9: 4,331,426 D600G possibly damaging Het
Klf13 G A 7: 63,891,600 probably benign Het
Kmt2d A G 15: 98,844,397 probably benign Het
Lama1 A G 17: 67,802,948 D2188G probably damaging Het
Leng8 A G 7: 4,145,274 T682A probably damaging Het
Mslnl G T 17: 25,737,842 G34V possibly damaging Het
Mycbp2 A T 14: 103,188,608 S2360R probably damaging Het
Mycbp2 C A 14: 103,188,615 probably null Het
Nkx2-2 T C 2: 147,184,399 T140A probably damaging Het
Olfr1233 A T 2: 89,339,705 V199E possibly damaging Het
Olfr745 T C 14: 50,643,067 V262A probably benign Het
Oser1 C T 2: 163,407,045 R79H probably damaging Het
Pfas A G 11: 68,991,132 V909A probably damaging Het
Pkhd1l1 A G 15: 44,532,992 E1970G probably benign Het
Prph2 G T 17: 46,910,667 probably benign Het
Rusc2 G T 4: 43,425,758 A1288S probably benign Het
Sdha A G 13: 74,323,839 probably null Het
Sec16a T G 2: 26,439,895 T703P probably benign Het
Senp7 T A 16: 56,173,208 N724K possibly damaging Het
Skint1 A G 4: 112,025,502 I248V probably benign Het
Slc9a5 T C 8: 105,357,013 V395A probably benign Het
Slco1a4 T C 6: 141,834,659 N135S possibly damaging Het
Sncaip A G 18: 52,894,956 I412M probably damaging Het
Tacc2 A T 7: 130,624,051 D841V possibly damaging Het
Tekt1 A T 11: 72,351,837 H281Q probably benign Het
Tex46 G T 4: 136,612,917 M104I probably benign Het
Tjp3 T C 10: 81,278,620 probably null Het
Treh A G 9: 44,682,678 Y154C probably damaging Het
Trim80 T A 11: 115,446,785 L428Q probably damaging Het
Trpm6 A G 19: 18,853,604 K1278E probably damaging Het
Usp34 T C 11: 23,375,024 M990T possibly damaging Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Ywhae T C 11: 75,756,924 M160T probably benign Het
Zcchc11 G A 4: 108,557,373 R49H probably damaging Het
Other mutations in Fam161a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Fam161a APN 11 23015894 unclassified probably benign
IGL01457:Fam161a APN 11 23020702 nonsense probably null
IGL01823:Fam161a APN 11 23015785 missense probably damaging 1.00
IGL02111:Fam161a APN 11 23020026 missense probably benign 0.05
3-1:Fam161a UTSW 11 23023429 critical splice acceptor site probably null
R0531:Fam161a UTSW 11 23020298 missense possibly damaging 0.49
R1524:Fam161a UTSW 11 23015826 missense possibly damaging 0.80
R1550:Fam161a UTSW 11 23020470 missense possibly damaging 0.58
R1599:Fam161a UTSW 11 23021093 missense probably benign 0.43
R3744:Fam161a UTSW 11 23020410 missense probably damaging 1.00
R3962:Fam161a UTSW 11 23023507 missense possibly damaging 0.82
R4352:Fam161a UTSW 11 23020798 missense possibly damaging 0.90
R4607:Fam161a UTSW 11 23020710 missense probably benign 0.03
R4820:Fam161a UTSW 11 23020076 missense probably damaging 1.00
R5057:Fam161a UTSW 11 23020397 missense probably damaging 1.00
R5207:Fam161a UTSW 11 23020583 nonsense probably null
R5705:Fam161a UTSW 11 23028869 missense unknown
R7107:Fam161a UTSW 11 23023452 missense possibly damaging 0.84
R7203:Fam161a UTSW 11 23021664 splice site probably null
R7242:Fam161a UTSW 11 23020037 missense possibly damaging 0.81
R7286:Fam161a UTSW 11 23020001 missense possibly damaging 0.58
R7483:Fam161a UTSW 11 23021006 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTTTCTGTCAGTTACCTAGGAATCTG -3'
(R):5'- AGGGACTTACCTCGAAGACG -3'

Sequencing Primer
(F):5'- CAGATCACTAGTTCGGAGCTAGC -3'
(R):5'- TCGAAGACGAATCGCTGATC -3'
Posted On2016-11-08