Incidental Mutation 'R5668:Olfr1427'
ID442484
Institutional Source Beutler Lab
Gene Symbol Olfr1427
Ensembl Gene ENSMUSG00000067525
Gene Nameolfactory receptor 1427
SynonymsMOR239-4, GA_x6K02T2RE5P-2458473-2457538
MMRRC Submission 043311-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5668 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12098006-12103334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12098926 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 238 (S238P)
Ref Sequence ENSEMBL: ENSMUSP00000150457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087825] [ENSMUST00000215374] [ENSMUST00000216069]
Predicted Effect probably damaging
Transcript: ENSMUST00000087825
AA Change: S238P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085127
Gene: ENSMUSG00000067525
AA Change: S238P

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.4e-47 PFAM
Pfam:7tm_1 41 304 6.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215374
AA Change: S238P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216069
AA Change: S238P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216845
Meta Mutation Damage Score 0.5240 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,904,550 W429R probably damaging Het
Afg1l C T 10: 42,360,240 C272Y probably damaging Het
Agrn T C 4: 156,167,313 T1831A probably damaging Het
AI481877 A G 4: 59,047,399 S1407P probably benign Het
Aifm2 T C 10: 61,725,917 V14A probably damaging Het
Angptl3 A T 4: 99,032,084 probably null Het
Arfgap1 A T 2: 180,974,119 D197V possibly damaging Het
Atp1a3 T C 7: 24,978,869 probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC067074 A G 13: 113,317,167 S55G possibly damaging Het
Brwd1 T C 16: 96,016,150 I1387M probably damaging Het
Cavin4 A G 4: 48,672,499 T315A probably benign Het
Cep128 T C 12: 90,999,636 T1066A probably benign Het
Cln3 T C 7: 126,572,386 T376A probably benign Het
Cntn4 A T 6: 106,679,436 silent Het
Colec12 T A 18: 9,848,963 D380E probably damaging Het
Csmd3 T C 15: 47,695,755 I2371V possibly damaging Het
Cxcl3 T C 5: 90,787,440 S99P unknown Het
Ddx60 A G 8: 62,000,578 R1244G probably benign Het
Dhx38 T C 8: 109,553,416 D914G probably damaging Het
Dlc1 T G 8: 36,937,501 probably benign Het
Fam161b A G 12: 84,356,350 S169P probably damaging Het
Fastkd1 A G 2: 69,707,381 S286P possibly damaging Het
Fmn2 A T 1: 174,582,037 E612V unknown Het
Foxb1 T A 9: 69,760,246 M1L probably damaging Het
Gm14412 A T 2: 177,315,609 C164* probably null Het
Gm43302 T A 5: 105,275,812 M432L probably benign Het
Gm4353 C A 7: 116,083,678 A223S probably damaging Het
Gm884 T A 11: 103,617,054 probably benign Het
Gm8994 A T 6: 136,329,395 I264F probably benign Het
Gpatch8 T C 11: 102,500,867 K143R unknown Het
Gpr15 A G 16: 58,717,650 S359P probably damaging Het
Gucy2e A G 11: 69,228,381 L649P probably damaging Het
H2-M10.5 C A 17: 36,774,581 H211N probably damaging Het
Hs6st1 T C 1: 36,103,889 Y302H probably damaging Het
Khdrbs2 A T 1: 32,467,770 D165V probably damaging Het
Klra13-ps T G 6: 130,304,283 noncoding transcript Het
Lrrc37a T A 11: 103,500,175 T1475S probably benign Het
Ly75 A G 2: 60,354,500 S437P probably damaging Het
Maz C T 7: 127,025,322 C342Y probably damaging Het
Mcf2l C A 8: 13,013,812 S1008* probably null Het
Mcmbp T C 7: 128,712,754 D246G probably benign Het
Mipol1 G A 12: 57,325,560 R135H possibly damaging Het
Mycbp2 T A 14: 103,120,519 Y4613F possibly damaging Het
Nup188 G A 2: 30,336,324 A1118T probably damaging Het
Olfr1226 A T 2: 89,193,826 D69E possibly damaging Het
Olfr1249 G A 2: 89,630,344 L185F probably damaging Het
Olfr267 T A 4: 58,785,489 I78F probably benign Het
Olfr573-ps1 T C 7: 102,941,921 K219E probably benign Het
Olfr585 A T 7: 103,097,896 S52C probably benign Het
Olfr981 A T 9: 40,022,668 I92F probably damaging Het
P3h1 T A 4: 119,244,046 I460N possibly damaging Het
Pcnt T C 10: 76,409,500 D1101G probably benign Het
Phlpp2 C A 8: 109,928,573 Q667K possibly damaging Het
Plec A G 15: 76,190,466 F434L possibly damaging Het
Ppp6r2 T A 15: 89,280,399 I602N probably damaging Het
Rdh8 A C 9: 20,825,179 I181L probably benign Het
Rnf181 A G 6: 72,361,522 M1T probably null Het
Rpl29-ps2 A G 13: 4,614,222 noncoding transcript Het
Sart3 A G 5: 113,745,156 probably null Het
Sec14l2 A C 11: 4,109,189 L160R probably damaging Het
Senp1 C T 15: 98,048,355 R503H probably damaging Het
Slc22a2 T C 17: 12,608,409 V316A probably benign Het
Slc34a1 A T 13: 55,409,085 I365F possibly damaging Het
Spag5 T C 11: 78,304,716 V283A possibly damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Sun3 A G 11: 9,031,433 probably null Het
Syt6 A G 3: 103,620,901 Y312C probably damaging Het
Tas2r121 T A 6: 132,700,793 Y72F possibly damaging Het
Tfrc A G 16: 32,623,376 Y473C probably damaging Het
Trp63 C T 16: 25,866,185 A274V possibly damaging Het
Trpm5 T C 7: 143,073,229 D1085G probably benign Het
Ttn A G 2: 76,914,664 V5347A probably benign Het
Vma21-ps T A 4: 52,496,946 Q100L possibly damaging Het
Vmn2r22 T C 6: 123,637,914 N239S probably benign Het
Wfdc8 T C 2: 164,597,419 probably benign Het
Xkr4 T A 1: 3,671,035 Y105F probably damaging Het
Xpo7 C T 14: 70,682,846 V627I possibly damaging Het
Zfp606 T C 7: 12,492,552 V200A probably benign Het
Zfp936 A T 7: 43,190,434 S441C possibly damaging Het
Other mutations in Olfr1427
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Olfr1427 APN 19 12099405 missense probably benign 0.00
IGL01520:Olfr1427 APN 19 12099636 start codon destroyed probably null 0.98
IGL01768:Olfr1427 APN 19 12099039 missense probably damaging 1.00
IGL02060:Olfr1427 APN 19 12099460 missense probably damaging 1.00
IGL02328:Olfr1427 APN 19 12098782 missense probably damaging 1.00
R0346:Olfr1427 UTSW 19 12099439 missense probably damaging 0.96
R1264:Olfr1427 UTSW 19 12098834 missense probably benign 0.42
R1702:Olfr1427 UTSW 19 12099166 missense probably benign 0.25
R1709:Olfr1427 UTSW 19 12098881 missense probably damaging 1.00
R4781:Olfr1427 UTSW 19 12099367 missense probably benign 0.01
R4821:Olfr1427 UTSW 19 12098746 missense probably benign 0.00
R5509:Olfr1427 UTSW 19 12098977 missense possibly damaging 0.94
R6156:Olfr1427 UTSW 19 12099120 missense possibly damaging 0.87
R6619:Olfr1427 UTSW 19 12099363 missense probably damaging 0.99
R6950:Olfr1427 UTSW 19 12099390 missense probably benign 0.00
R7008:Olfr1427 UTSW 19 12098850 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TTCCGGAGTCTCTTCATGGC -3'
(R):5'- GTGGACCCAATGTTGTTGATAG -3'

Sequencing Primer
(F):5'- GGAGTCTCTTCATGGCTGATTTCATC -3'
(R):5'- GATAGTTTTTACTGTGATGTCCCAC -3'
Posted On2016-11-09