Incidental Mutation 'R5694:Serinc5'
ID443837
Institutional Source Beutler Lab
Gene Symbol Serinc5
Ensembl Gene ENSMUSG00000021703
Gene Nameserine incorporator 5
SynonymsTPO1, AIGP3, A130038L21Rik
MMRRC Submission 043325-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R5694 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location92611091-92711947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92688794 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 244 (I244V)
Ref Sequence ENSEMBL: ENSMUSP00000047547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049488]
Predicted Effect probably benign
Transcript: ENSMUST00000049488
AA Change: I244V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000047547
Gene: ENSMUSG00000021703
AA Change: I244V

DomainStartEndE-ValueType
Pfam:Serinc 12 458 6.8e-155 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224250
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,600,947 I1353N probably damaging Het
Actr1a C A 19: 46,395,718 probably benign Het
Adamts14 A T 10: 61,229,652 M356K probably benign Het
Adamtsl2 A G 2: 27,081,724 H7R probably benign Het
Angptl2 T C 2: 33,228,616 V134A probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Astn2 T C 4: 65,950,138 D488G probably damaging Het
Cat A T 2: 103,472,994 V146E probably damaging Het
Dmxl1 T C 18: 49,894,257 V2144A probably damaging Het
Efcab5 T G 11: 77,188,875 D15A probably benign Het
Epha10 C T 4: 124,902,653 A385V unknown Het
Erg C A 16: 95,361,031 E388D probably benign Het
Fam126a C A 5: 23,991,796 L31F probably damaging Het
Fbxo10 T A 4: 45,035,970 I931F probably damaging Het
Frem1 A G 4: 82,994,116 L673P probably damaging Het
Gm4922 A C 10: 18,784,287 I229S possibly damaging Het
Gnptab T A 10: 88,414,486 D153E probably benign Het
Htr7 T C 19: 36,057,121 M45V probably benign Het
Igkv4-51 C T 6: 69,681,927 V5M probably damaging Het
Ints7 G A 1: 191,586,618 E156K probably damaging Het
Map3k21 A G 8: 125,944,768 T932A probably benign Het
Mapk1 T G 16: 17,018,469 D160E probably benign Het
Mast4 A T 13: 102,774,193 Y479* probably null Het
Meig1 T A 2: 3,411,962 K7N probably damaging Het
Mthfd1l T A 10: 4,035,239 D548E possibly damaging Het
Myo16 A G 8: 10,569,606 R1386G probably benign Het
Nphs2 T C 1: 156,326,037 S353P probably benign Het
Olfr533 T C 7: 140,466,731 F177L probably benign Het
Olfr906 T A 9: 38,488,236 I69K probably damaging Het
Pcdha9 G T 18: 36,998,372 V165L probably benign Het
Pde3a T A 6: 141,250,502 S305T possibly damaging Het
Phf14 C A 6: 11,990,125 L718I possibly damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Rab44 T C 17: 29,140,500 L554P probably damaging Het
Rab44 T A 17: 29,145,966 M645K unknown Het
Rnf222 A G 11: 68,892,897 T97A probably benign Het
Rnpepl1 T C 1: 92,918,941 S522P probably benign Het
Serpinb10 A T 1: 107,535,457 probably null Het
Siglech T A 7: 55,768,656 F124Y probably damaging Het
Smarcc2 A T 10: 128,484,127 I790L probably benign Het
Sos2 C A 12: 69,590,915 R1007S probably damaging Het
Stk4 C T 2: 164,100,564 T372M possibly damaging Het
Tbc1d10c A T 19: 4,184,964 L366H probably damaging Het
Tor4a T C 2: 25,194,920 T324A probably benign Het
Trim12a C A 7: 104,307,243 C30F probably damaging Het
Ttll3 G A 6: 113,399,708 V350M probably damaging Het
Uggt1 A T 1: 36,179,656 D63E probably damaging Het
Unc5b G A 10: 60,773,747 T590I probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls A C 3: 159,839,987 I16L probably benign Het
Zfp101 T C 17: 33,380,945 I612M probably benign Het
Zfp677 C A 17: 21,397,759 D359E probably damaging Het
Other mutations in Serinc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Serinc5 APN 13 92706271 missense probably damaging 0.96
IGL01954:Serinc5 APN 13 92682933 missense probably damaging 1.00
IGL02248:Serinc5 APN 13 92706140 missense probably damaging 1.00
IGL03259:Serinc5 APN 13 92690992 missense probably damaging 1.00
R0352:Serinc5 UTSW 13 92707989 splice site probably null
R0600:Serinc5 UTSW 13 92708057 missense probably damaging 1.00
R0646:Serinc5 UTSW 13 92688737 missense possibly damaging 0.82
R0944:Serinc5 UTSW 13 92661105 missense probably damaging 1.00
R0972:Serinc5 UTSW 13 92688620 missense probably benign 0.18
R1163:Serinc5 UTSW 13 92682777 missense probably damaging 1.00
R1459:Serinc5 UTSW 13 92661187 critical splice donor site probably null
R1703:Serinc5 UTSW 13 92688797 missense probably damaging 0.99
R1866:Serinc5 UTSW 13 92706263 missense probably damaging 0.99
R1887:Serinc5 UTSW 13 92701706 missense possibly damaging 0.70
R3018:Serinc5 UTSW 13 92688681 missense probably benign 0.01
R4863:Serinc5 UTSW 13 92690980 missense probably damaging 1.00
R5715:Serinc5 UTSW 13 92706202 missense probably damaging 1.00
R5979:Serinc5 UTSW 13 92661136 missense probably benign 0.01
R6228:Serinc5 UTSW 13 92708108 missense probably damaging 1.00
R6270:Serinc5 UTSW 13 92688662 missense probably damaging 0.97
R6592:Serinc5 UTSW 13 92708126 missense possibly damaging 0.88
R6622:Serinc5 UTSW 13 92688686 missense probably benign 0.05
R6787:Serinc5 UTSW 13 92706232 missense possibly damaging 0.60
R7730:Serinc5 UTSW 13 92685190 missense probably damaging 1.00
R7773:Serinc5 UTSW 13 92661084 missense probably damaging 1.00
X0018:Serinc5 UTSW 13 92661075 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCACCGTCCGTAATAAGCTG -3'
(R):5'- AAAGGTTCCCTGTGTGCACTG -3'

Sequencing Primer
(F):5'- AATAAGCTGTGGTACGCCTC -3'
(R):5'- GTTATTACCTCCAAATGGGCATGG -3'
Posted On2016-11-09