Incidental Mutation 'R5778:Iltifb'
ID446833
Institutional Source Beutler Lab
Gene Symbol Iltifb
Ensembl Gene ENSMUSG00000090461
Gene Nameinterleukin 10-related T cell-derived inducible factor beta
SynonymsIL-TIFb
MMRRC Submission 043376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5778 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location118289629-118295038 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 118294863 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 43 (E43*)
Ref Sequence ENSEMBL: ENSMUSP00000128415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163808]
Predicted Effect probably null
Transcript: ENSMUST00000163808
AA Change: E43*
SMART Domains Protein: ENSMUSP00000128415
Gene: ENSMUSG00000090461
AA Change: E43*

DomainStartEndE-ValueType
IL10 49 179 5.21e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179123
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,958,714 I1848F probably damaging Het
Acta1 A G 8: 123,892,125 S340P probably benign Het
Anpep T C 7: 79,836,391 T528A probably benign Het
Apob T A 12: 8,015,074 D4014E probably benign Het
Atp23 A G 10: 126,899,582 C78R probably damaging Het
Atp8b3 A G 10: 80,520,173 F1235S probably benign Het
B3gnt3 T C 8: 71,692,938 D262G probably benign Het
Brca1 G A 11: 101,525,301 A669V possibly damaging Het
Caprin2 A T 6: 148,869,322 S391R probably benign Het
Cdh15 G A 8: 122,856,587 R43Q possibly damaging Het
Celsr1 A T 15: 86,032,955 N272K probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Dsg1b A T 18: 20,409,222 T929S possibly damaging Het
Dusp16 G T 6: 134,718,314 T518N probably benign Het
Eno2 A T 6: 124,766,298 H158Q probably damaging Het
Ep400 T C 5: 110,719,584 D954G unknown Het
Erg28 T C 12: 85,819,480 T75A possibly damaging Het
Fam135b T A 15: 71,479,032 T332S probably damaging Het
Fam19a3 T A 3: 104,772,189 K126N probably damaging Het
Fam221b A G 4: 43,660,683 F357L probably damaging Het
Fcgr2b C T 1: 170,963,388 G279R probably damaging Het
Fryl A T 5: 73,072,778 L1679M probably damaging Het
Galm T A 17: 80,127,717 M1K probably null Het
Gsg1 A T 6: 135,244,350 I17N possibly damaging Het
Hif3a A T 7: 17,051,984 I129N probably damaging Het
Ighv1-11 A T 12: 114,612,431 W55R probably damaging Het
Ighv1-20 C A 12: 114,723,877 K82N probably benign Het
Igsf21 C T 4: 140,037,521 E148K probably benign Het
Klhdc7b A T 15: 89,387,320 R802W probably damaging Het
Krt8 T C 15: 102,003,939 I101V probably damaging Het
Lrrc7 A G 3: 158,170,743 L570P probably damaging Het
Map4k1 C G 7: 28,994,221 N412K probably benign Het
Metrnl A T 11: 121,714,738 I118F possibly damaging Het
Mmp12 T A 9: 7,350,106 D202E probably damaging Het
Mpp2 A T 11: 102,064,443 S119T probably benign Het
Ncoa6 T C 2: 155,406,768 T1539A probably benign Het
Nlrc5 A G 8: 94,479,526 T715A possibly damaging Het
Nsd1 T A 13: 55,306,979 N1963K probably damaging Het
Nsd3 T C 8: 25,659,818 Y340H probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1167 T A 2: 88,149,617 Y134F probably damaging Het
Olfr77 G T 9: 19,921,041 M277I probably benign Het
Pcdh8 T C 14: 79,770,757 E122G probably damaging Het
Pcmtd2 A C 2: 181,855,198 T323P probably benign Het
Pign C A 1: 105,591,722 G492C probably damaging Het
Plppr3 A G 10: 79,866,503 V245A possibly damaging Het
Prl7a2 C T 13: 27,661,000 W134* probably null Het
Prom1 A T 5: 44,007,047 N722K probably benign Het
Rasal2 A T 1: 157,161,290 N663K probably damaging Het
Rgl1 G T 1: 152,552,421 H315Q probably benign Het
Smpdl3a C A 10: 57,801,001 A65E probably damaging Het
Spdye4b G A 5: 143,202,387 D212N probably damaging Het
Tanc1 G T 2: 59,699,347 probably null Het
Trio A G 15: 27,856,164 V706A probably benign Het
Tshz1 T A 18: 84,015,680 Q201L probably damaging Het
Ubqln1 C T 13: 58,183,317 M365I probably benign Het
Usp42 A T 5: 143,719,576 Y383N probably damaging Het
Vmn1r189 A G 13: 22,102,382 I95T probably damaging Het
Vmn2r49 A T 7: 9,976,347 S819R probably damaging Het
Other mutations in Iltifb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Iltifb APN 10 118290164 missense possibly damaging 0.70
IGL02149:Iltifb APN 10 118294997 utr 5 prime probably benign
IGL02965:Iltifb APN 10 118294857 missense probably damaging 0.98
R0310:Iltifb UTSW 10 118293185 missense probably benign 0.41
R0730:Iltifb UTSW 10 118294237 missense probably benign 0.01
R1078:Iltifb UTSW 10 118290151 makesense probably null
R4067:Iltifb UTSW 10 118290210 missense probably damaging 0.99
R4158:Iltifb UTSW 10 118293132 missense probably damaging 1.00
R4911:Iltifb UTSW 10 118294989 start codon destroyed probably null 0.99
R5433:Iltifb UTSW 10 118294884 missense probably damaging 0.96
R7295:Iltifb UTSW 10 118294943 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACCCAGTCCTTAAAAGAGTCTC -3'
(R):5'- TTACCATGCTACCCGACGAG -3'

Sequencing Primer
(F):5'- CCCAGTCCTTAAAAGAGTCTCTAAAG -3'
(R):5'- ATGCTACCCGACGAGCATGTTC -3'
Posted On2016-12-15