Incidental Mutation 'R5778:Brca1'
ID446836
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
MMRRC Submission 043376-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5778 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101525301 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 669 (A669V)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017290
AA Change: A669V

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: A669V

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131460
Predicted Effect probably benign
Transcript: ENSMUST00000142086
SMART Domains Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
RING 24 64 8.6e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188168
Predicted Effect probably benign
Transcript: ENSMUST00000191198
SMART Domains Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
Pfam:EIN3 1 146 3.5e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,958,714 I1848F probably damaging Het
Acta1 A G 8: 123,892,125 S340P probably benign Het
Anpep T C 7: 79,836,391 T528A probably benign Het
Apob T A 12: 8,015,074 D4014E probably benign Het
Atp23 A G 10: 126,899,582 C78R probably damaging Het
Atp8b3 A G 10: 80,520,173 F1235S probably benign Het
B3gnt3 T C 8: 71,692,938 D262G probably benign Het
Caprin2 A T 6: 148,869,322 S391R probably benign Het
Cdh15 G A 8: 122,856,587 R43Q possibly damaging Het
Celsr1 A T 15: 86,032,955 N272K probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Dsg1b A T 18: 20,409,222 T929S possibly damaging Het
Dusp16 G T 6: 134,718,314 T518N probably benign Het
Eno2 A T 6: 124,766,298 H158Q probably damaging Het
Ep400 T C 5: 110,719,584 D954G unknown Het
Erg28 T C 12: 85,819,480 T75A possibly damaging Het
Fam135b T A 15: 71,479,032 T332S probably damaging Het
Fam19a3 T A 3: 104,772,189 K126N probably damaging Het
Fam221b A G 4: 43,660,683 F357L probably damaging Het
Fcgr2b C T 1: 170,963,388 G279R probably damaging Het
Fryl A T 5: 73,072,778 L1679M probably damaging Het
Galm T A 17: 80,127,717 M1K probably null Het
Gsg1 A T 6: 135,244,350 I17N possibly damaging Het
Hif3a A T 7: 17,051,984 I129N probably damaging Het
Ighv1-11 A T 12: 114,612,431 W55R probably damaging Het
Ighv1-20 C A 12: 114,723,877 K82N probably benign Het
Igsf21 C T 4: 140,037,521 E148K probably benign Het
Iltifb C A 10: 118,294,863 E43* probably null Het
Klhdc7b A T 15: 89,387,320 R802W probably damaging Het
Krt8 T C 15: 102,003,939 I101V probably damaging Het
Lrrc7 A G 3: 158,170,743 L570P probably damaging Het
Map4k1 C G 7: 28,994,221 N412K probably benign Het
Metrnl A T 11: 121,714,738 I118F possibly damaging Het
Mmp12 T A 9: 7,350,106 D202E probably damaging Het
Mpp2 A T 11: 102,064,443 S119T probably benign Het
Ncoa6 T C 2: 155,406,768 T1539A probably benign Het
Nlrc5 A G 8: 94,479,526 T715A possibly damaging Het
Nsd1 T A 13: 55,306,979 N1963K probably damaging Het
Nsd3 T C 8: 25,659,818 Y340H probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1167 T A 2: 88,149,617 Y134F probably damaging Het
Olfr77 G T 9: 19,921,041 M277I probably benign Het
Pcdh8 T C 14: 79,770,757 E122G probably damaging Het
Pcmtd2 A C 2: 181,855,198 T323P probably benign Het
Pign C A 1: 105,591,722 G492C probably damaging Het
Plppr3 A G 10: 79,866,503 V245A possibly damaging Het
Prl7a2 C T 13: 27,661,000 W134* probably null Het
Prom1 A T 5: 44,007,047 N722K probably benign Het
Rasal2 A T 1: 157,161,290 N663K probably damaging Het
Rgl1 G T 1: 152,552,421 H315Q probably benign Het
Smpdl3a C A 10: 57,801,001 A65E probably damaging Het
Spdye4b G A 5: 143,202,387 D212N probably damaging Het
Tanc1 G T 2: 59,699,347 probably null Het
Trio A G 15: 27,856,164 V706A probably benign Het
Tshz1 T A 18: 84,015,680 Q201L probably damaging Het
Ubqln1 C T 13: 58,183,317 M365I probably benign Het
Usp42 A T 5: 143,719,576 Y383N probably damaging Het
Vmn1r189 A G 13: 22,102,382 I95T probably damaging Het
Vmn2r49 A T 7: 9,976,347 S819R probably damaging Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7944:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCGAGTTCTTTGGCACTGTC -3'
(R):5'- GGAGGAAGTCTTCTATCAGGTG -3'

Sequencing Primer
(F):5'- GCACTGTCAGACATTTGGC -3'
(R):5'- AGGTGTGCTCTTCCACTTGAAC -3'
Posted On2016-12-15