Incidental Mutation 'R5805:Kifc2'
ID448467
Institutional Source Beutler Lab
Gene Symbol Kifc2
Ensembl Gene ENSMUSG00000004187
Gene Namekinesin family member C2
Synonyms
MMRRC Submission 043212-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5805 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76659858-76668196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76662153 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 245 (A245V)
Ref Sequence ENSEMBL: ENSMUSP00000004294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004294] [ENSMUST00000066677] [ENSMUST00000081291] [ENSMUST00000177359] [ENSMUST00000230451] [ENSMUST00000230964] [ENSMUST00000231152]
Predicted Effect probably benign
Transcript: ENSMUST00000004294
AA Change: A245V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000004294
Gene: ENSMUSG00000004187
AA Change: A245V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 36 45 N/A INTRINSIC
low complexity region 117 129 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
coiled coil region 195 235 N/A INTRINSIC
coiled coil region 274 345 N/A INTRINSIC
KISc 407 740 3.21e-141 SMART
low complexity region 745 781 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066677
SMART Domains Protein: ENSMUSP00000063317
Gene: ENSMUSG00000053929

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
transmembrane domain 35 52 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
transmembrane domain 91 108 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081291
SMART Domains Protein: ENSMUSP00000080043
Gene: ENSMUSG00000053929

DomainStartEndE-ValueType
SCOP:d1jm7a_ 21 88 3e-5 SMART
Blast:RING 27 62 8e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177359
SMART Domains Protein: ENSMUSP00000135505
Gene: ENSMUSG00000053929

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
transmembrane domain 35 52 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
transmembrane domain 91 108 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230124
Predicted Effect probably benign
Transcript: ENSMUST00000230451
AA Change: A160V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230719
Predicted Effect probably benign
Transcript: ENSMUST00000230964
Predicted Effect probably benign
Transcript: ENSMUST00000231152
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with no apparent defects in development or behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 C T 11: 110,279,390 C1293Y probably benign Het
Adam8 T A 7: 139,985,881 D611V probably damaging Het
Arhgap33 T C 7: 30,526,414 T576A probably benign Het
Atf7 A T 15: 102,557,587 probably null Het
Baiap3 T A 17: 25,247,515 T464S probably benign Het
Ccdc40 T C 11: 119,246,080 probably null Het
Celf2 T C 2: 6,553,787 E430G probably damaging Het
Chia1 A G 3: 106,128,476 T211A probably damaging Het
Ciz1 T C 2: 32,367,396 F151S probably damaging Het
Dnm2 A G 9: 21,467,669 T175A probably damaging Het
Doc2b A G 11: 75,772,538 S363P probably damaging Het
Garem1 C T 18: 21,148,435 R288H probably benign Het
Gm15448 G A 7: 3,822,623 L416F probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Helz2 C A 2: 181,240,508 C164F probably damaging Het
Itfg1 A T 8: 85,766,972 S293T probably benign Het
Kcnn2 T A 18: 45,683,131 D336E probably damaging Het
Krt18 T A 15: 102,031,300 I311N probably benign Het
Lypla1 T C 1: 4,830,294 M7T possibly damaging Het
Mef2a T C 7: 67,251,668 M285V possibly damaging Het
Micu1 A C 10: 59,827,306 K353Q possibly damaging Het
Mpv17l A G 16: 13,942,149 probably benign Het
Ntrk1 G A 3: 87,780,172 R652W probably damaging Het
Olfr1212 G A 2: 88,958,641 M58I possibly damaging Het
Olfr155 T C 4: 43,855,152 I281T probably benign Het
Olfr61 T A 7: 140,638,471 F257I probably benign Het
Pcdh15 C A 10: 74,230,259 T252K probably damaging Het
Pcsk5 T C 19: 17,456,829 M1392V probably benign Het
Phf20 T A 2: 156,307,294 V964E probably damaging Het
Plcg2 T C 8: 117,598,495 probably null Het
Pqlc1 C T 18: 80,263,443 P76L probably damaging Het
Rnf10 A T 5: 115,244,068 C693S probably benign Het
Rnf19b A G 4: 129,058,824 Y185C probably damaging Het
Ros1 G T 10: 52,123,289 D1167E probably damaging Het
Sidt2 G A 9: 45,942,199 S701L probably damaging Het
Spag1 T C 15: 36,200,284 I345T probably damaging Het
Srcap T A 7: 127,542,039 S1603T possibly damaging Het
Stag1 T A 9: 100,796,778 Y251N probably damaging Het
Stxbp5 T C 10: 9,900,586 N33S probably benign Het
Tnrc6a T C 7: 123,170,076 L363P probably damaging Het
U2surp C T 9: 95,479,304 R591H possibly damaging Het
Usf3 A G 16: 44,220,746 N1863S possibly damaging Het
Vmn2r15 T C 5: 109,286,940 I633V possibly damaging Het
Zfp979 T C 4: 147,613,610 D214G probably damaging Het
Other mutations in Kifc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Kifc2 APN 15 76667462 utr 3 prime probably benign
IGL01341:Kifc2 APN 15 76662898 critical splice donor site probably null
IGL02161:Kifc2 APN 15 76666045 missense probably damaging 1.00
IGL02675:Kifc2 APN 15 76662979 missense probably damaging 1.00
IGL02997:Kifc2 APN 15 76664339 missense possibly damaging 0.83
R0034:Kifc2 UTSW 15 76667100 missense probably benign 0.18
R1818:Kifc2 UTSW 15 76666081 missense probably damaging 1.00
R1961:Kifc2 UTSW 15 76662825 missense probably damaging 1.00
R2104:Kifc2 UTSW 15 76661254 missense probably damaging 0.99
R2149:Kifc2 UTSW 15 76662221 missense probably benign 0.00
R3086:Kifc2 UTSW 15 76667252 missense probably benign 0.01
R4704:Kifc2 UTSW 15 76662977 unclassified probably null
R4782:Kifc2 UTSW 15 76664348 missense possibly damaging 0.89
R4834:Kifc2 UTSW 15 76661311 start codon destroyed probably null 0.48
R5085:Kifc2 UTSW 15 76661296 missense probably damaging 1.00
R5160:Kifc2 UTSW 15 76662977 missense probably damaging 1.00
R5253:Kifc2 UTSW 15 76666281 missense possibly damaging 0.94
R5543:Kifc2 UTSW 15 76667042 missense probably damaging 0.99
R5786:Kifc2 UTSW 15 76664378 missense probably damaging 1.00
R7290:Kifc2 UTSW 15 76660704 missense probably damaging 1.00
R7311:Kifc2 UTSW 15 76662810 missense probably damaging 1.00
R7511:Kifc2 UTSW 15 76661337 missense possibly damaging 0.50
R7782:Kifc2 UTSW 15 76664128 missense probably benign 0.00
Z1177:Kifc2 UTSW 15 76661288 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAGCTGAGTAGACTTCGTCTGG -3'
(R):5'- TCCTGAGGTTTCACAGAGAGAC -3'

Sequencing Primer
(F):5'- AGTAGACTTCGTCTGGGAGTG -3'
(R):5'- GTTCATAGTTAGAGATGGCCCCCAC -3'
Posted On2016-12-15