Incidental Mutation 'R5805:Micu1'
ID448460
Institutional Source Beutler Lab
Gene Symbol Micu1
Ensembl Gene ENSMUSG00000020111
Gene Namemitochondrial calcium uptake 1
SynonymsC730016L05Rik, Cbara1
MMRRC Submission 043212-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R5805 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location59702477-59864132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 59827306 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 353 (K353Q)
Ref Sequence ENSEMBL: ENSMUSP00000136567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020311] [ENSMUST00000092508] [ENSMUST00000165563] [ENSMUST00000179709]
Predicted Effect probably benign
Transcript: ENSMUST00000020311
AA Change: K359Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020311
Gene: ENSMUSG00000020111
AA Change: K359Q

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 230 258 8.16e-1 SMART
EFh 420 448 4.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092508
AA Change: K357Q

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090166
Gene: ENSMUSG00000020111
AA Change: K357Q

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 228 256 8.16e-1 SMART
EFh 418 446 4.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165563
AA Change: K353Q

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126597
Gene: ENSMUSG00000020111
AA Change: K353Q

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 224 252 8.16e-1 SMART
EFh 414 442 4.12e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169842
Predicted Effect possibly damaging
Transcript: ENSMUST00000179709
AA Change: K353Q

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136567
Gene: ENSMUSG00000020111
AA Change: K353Q

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 224 252 8.16e-1 SMART
EFh 414 442 4.12e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of mitochondrial Ca2+ uptake under basal conditions. The encoded protein interacts with the mitochondrial calcium uniporter, a mitochondrial inner membrane Ca2+ channel, and is essential in preventing mitochondrial Ca2+ overload, which can cause excessive production of reactive oxygen species and cell stress. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 C T 11: 110,279,390 C1293Y probably benign Het
Adam8 T A 7: 139,985,881 D611V probably damaging Het
Arhgap33 T C 7: 30,526,414 T576A probably benign Het
Atf7 A T 15: 102,557,587 probably null Het
Baiap3 T A 17: 25,247,515 T464S probably benign Het
Ccdc40 T C 11: 119,246,080 probably null Het
Celf2 T C 2: 6,553,787 E430G probably damaging Het
Chia1 A G 3: 106,128,476 T211A probably damaging Het
Ciz1 T C 2: 32,367,396 F151S probably damaging Het
Dnm2 A G 9: 21,467,669 T175A probably damaging Het
Doc2b A G 11: 75,772,538 S363P probably damaging Het
Garem1 C T 18: 21,148,435 R288H probably benign Het
Gm15448 G A 7: 3,822,623 L416F probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Helz2 C A 2: 181,240,508 C164F probably damaging Het
Itfg1 A T 8: 85,766,972 S293T probably benign Het
Kcnn2 T A 18: 45,683,131 D336E probably damaging Het
Kifc2 C T 15: 76,662,153 A245V probably benign Het
Krt18 T A 15: 102,031,300 I311N probably benign Het
Lypla1 T C 1: 4,830,294 M7T possibly damaging Het
Mef2a T C 7: 67,251,668 M285V possibly damaging Het
Mpv17l A G 16: 13,942,149 probably benign Het
Ntrk1 G A 3: 87,780,172 R652W probably damaging Het
Olfr1212 G A 2: 88,958,641 M58I possibly damaging Het
Olfr155 T C 4: 43,855,152 I281T probably benign Het
Olfr61 T A 7: 140,638,471 F257I probably benign Het
Pcdh15 C A 10: 74,230,259 T252K probably damaging Het
Pcsk5 T C 19: 17,456,829 M1392V probably benign Het
Phf20 T A 2: 156,307,294 V964E probably damaging Het
Plcg2 T C 8: 117,598,495 probably null Het
Pqlc1 C T 18: 80,263,443 P76L probably damaging Het
Rnf10 A T 5: 115,244,068 C693S probably benign Het
Rnf19b A G 4: 129,058,824 Y185C probably damaging Het
Ros1 G T 10: 52,123,289 D1167E probably damaging Het
Sidt2 G A 9: 45,942,199 S701L probably damaging Het
Spag1 T C 15: 36,200,284 I345T probably damaging Het
Srcap T A 7: 127,542,039 S1603T possibly damaging Het
Stag1 T A 9: 100,796,778 Y251N probably damaging Het
Stxbp5 T C 10: 9,900,586 N33S probably benign Het
Tnrc6a T C 7: 123,170,076 L363P probably damaging Het
U2surp C T 9: 95,479,304 R591H possibly damaging Het
Usf3 A G 16: 44,220,746 N1863S possibly damaging Het
Vmn2r15 T C 5: 109,286,940 I633V possibly damaging Het
Zfp979 T C 4: 147,613,610 D214G probably damaging Het
Other mutations in Micu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Micu1 APN 10 59863278 missense possibly damaging 0.55
IGL02643:Micu1 APN 10 59839736 missense probably damaging 1.00
IGL03183:Micu1 APN 10 59728048 nonsense probably null
R0025:Micu1 UTSW 10 59788877 critical splice acceptor site probably null
R0645:Micu1 UTSW 10 59839681 missense possibly damaging 0.95
R0988:Micu1 UTSW 10 59756727 intron probably benign
R1121:Micu1 UTSW 10 59788982 missense possibly damaging 0.50
R1334:Micu1 UTSW 10 59788976 missense probably damaging 1.00
R1762:Micu1 UTSW 10 59863260 missense possibly damaging 0.70
R1925:Micu1 UTSW 10 59733161 splice site probably benign
R1976:Micu1 UTSW 10 59768213 missense probably damaging 1.00
R2082:Micu1 UTSW 10 59863307 missense probably benign 0.00
R2152:Micu1 UTSW 10 59863288 missense probably benign 0.01
R2395:Micu1 UTSW 10 59863202 nonsense probably null
R3619:Micu1 UTSW 10 59768258 splice site probably null
R3953:Micu1 UTSW 10 59750504 missense probably benign 0.01
R4809:Micu1 UTSW 10 59740822 missense probably benign
R4948:Micu1 UTSW 10 59863254 missense possibly damaging 0.56
R5103:Micu1 UTSW 10 59788984 missense possibly damaging 0.79
R5137:Micu1 UTSW 10 59827232 missense probably benign 0.20
R5431:Micu1 UTSW 10 59750521 missense possibly damaging 0.92
R6910:Micu1 UTSW 10 59740667 missense probably damaging 1.00
R7030:Micu1 UTSW 10 59789021 missense possibly damaging 0.92
R7845:Micu1 UTSW 10 59839785 critical splice donor site probably null
R7928:Micu1 UTSW 10 59839785 critical splice donor site probably null
Z1177:Micu1 UTSW 10 59728041 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGCCAGATTCATTTCTCCC -3'
(R):5'- CCATCGTTTTCAATCTGTGCAAG -3'

Sequencing Primer
(F):5'- ATTTCTCCCCTCAAACACAATTG -3'
(R):5'- CAAGAGACCTGGGGTTATTCTACC -3'
Posted On2016-12-15