Mutagenetix > Incidental Mutations

Incidental Mutation 'R5805:Micu1'

448460

Institutional Source

Beutler Lab

Gene Symbol

Micu1

Ensembl Gene

ENSMUSG00000020111

Gene Name

mitochondrial calcium uptake 1

Synonyms

C730016L05Rik, Cbara1

MMRRC Submission

043212-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.628) question?

Stock #

R5805 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59702477-59864132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 59827306 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 353 (K353Q)

Ref Sequence

ENSEMBL: ENSMUSP00000136567 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020311] [ENSMUST00000092508] [ENSMUST00000165563] [ENSMUST00000179709]

Predicted Effect

probably benign
Transcript: ENSMUST00000020311
AA Change: K359Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000020311
Gene: ENSMUSG00000020111
AA Change: K359Q

Domain	Start	End	E-Value	Type
low complexity region	89	94	N/A	INTRINSIC
EFh	230	258	8.16e-1	SMART
EFh	420	448	4.12e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000092508
AA Change: K357Q

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000090166
Gene: ENSMUSG00000020111
AA Change: K357Q

Domain	Start	End	E-Value	Type
low complexity region	89	94	N/A	INTRINSIC
EFh	228	256	8.16e-1	SMART
EFh	418	446	4.12e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165563
AA Change: K353Q

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000126597
Gene: ENSMUSG00000020111
AA Change: K353Q

Domain	Start	End	E-Value	Type
low complexity region	89	94	N/A	INTRINSIC
EFh	224	252	8.16e-1	SMART
EFh	414	442	4.12e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169842

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179709
AA Change: K353Q

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000136567
Gene: ENSMUSG00000020111
AA Change: K353Q

Domain	Start	End	E-Value	Type
low complexity region	89	94	N/A	INTRINSIC
EFh	224	252	8.16e-1	SMART
EFh	414	442	4.12e-3	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of mitochondrial Ca2+ uptake under basal conditions. The encoded protein interacts with the mitochondrial calcium uniporter, a mitochondrial inner membrane Ca2+ channel, and is essential in preventing mitochondrial Ca2+ overload, which can cause excessive production of reactive oxygen species and cell stress. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2013]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	C	T	11: 110,279,390	C1293Y	probably benign	Het
Adam8	T	A	7: 139,985,881	D611V	probably damaging	Het
Arhgap33	T	C	7: 30,526,414	T576A	probably benign	Het
Atf7	A	T	15: 102,557,587		probably null	Het
Baiap3	T	A	17: 25,247,515	T464S	probably benign	Het
Ccdc40	T	C	11: 119,246,080		probably null	Het
Celf2	T	C	2: 6,553,787	E430G	probably damaging	Het
Chia1	A	G	3: 106,128,476	T211A	probably damaging	Het
Ciz1	T	C	2: 32,367,396	F151S	probably damaging	Het
Dnm2	A	G	9: 21,467,669	T175A	probably damaging	Het
Doc2b	A	G	11: 75,772,538	S363P	probably damaging	Het
Garem1	C	T	18: 21,148,435	R288H	probably benign	Het
Gm15448	G	A	7: 3,822,623	L416F	probably benign	Het
Gpr132	G	A	12: 112,852,796	R137C	probably damaging	Het
Helz2	C	A	2: 181,240,508	C164F	probably damaging	Het
Itfg1	A	T	8: 85,766,972	S293T	probably benign	Het
Kcnn2	T	A	18: 45,683,131	D336E	probably damaging	Het
Kifc2	C	T	15: 76,662,153	A245V	probably benign	Het
Krt18	T	A	15: 102,031,300	I311N	probably benign	Het
Lypla1	T	C	1: 4,830,294	M7T	possibly damaging	Het
Mef2a	T	C	7: 67,251,668	M285V	possibly damaging	Het
Mpv17l	A	G	16: 13,942,149		probably benign	Het
Ntrk1	G	A	3: 87,780,172	R652W	probably damaging	Het
Olfr1212	G	A	2: 88,958,641	M58I	possibly damaging	Het
Olfr155	T	C	4: 43,855,152	I281T	probably benign	Het
Olfr61	T	A	7: 140,638,471	F257I	probably benign	Het
Pcdh15	C	A	10: 74,230,259	T252K	probably damaging	Het
Pcsk5	T	C	19: 17,456,829	M1392V	probably benign	Het
Phf20	T	A	2: 156,307,294	V964E	probably damaging	Het
Plcg2	T	C	8: 117,598,495		probably null	Het
Pqlc1	C	T	18: 80,263,443	P76L	probably damaging	Het
Rnf10	A	T	5: 115,244,068	C693S	probably benign	Het
Rnf19b	A	G	4: 129,058,824	Y185C	probably damaging	Het
Ros1	G	T	10: 52,123,289	D1167E	probably damaging	Het
Sidt2	G	A	9: 45,942,199	S701L	probably damaging	Het
Spag1	T	C	15: 36,200,284	I345T	probably damaging	Het
Srcap	T	A	7: 127,542,039	S1603T	possibly damaging	Het
Stag1	T	A	9: 100,796,778	Y251N	probably damaging	Het
Stxbp5	T	C	10: 9,900,586	N33S	probably benign	Het
Tnrc6a	T	C	7: 123,170,076	L363P	probably damaging	Het
U2surp	C	T	9: 95,479,304	R591H	possibly damaging	Het
Usf3	A	G	16: 44,220,746	N1863S	possibly damaging	Het
Vmn2r15	T	C	5: 109,286,940	I633V	possibly damaging	Het
Zfp979	T	C	4: 147,613,610	D214G	probably damaging	Het

Other mutations in Micu1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01982:Micu1	APN	10	59863278	missense	possibly damaging	0.55
IGL02643:Micu1	APN	10	59839736	missense	probably damaging	1.00
IGL03183:Micu1	APN	10	59728048	nonsense	probably null
R0025:Micu1	UTSW	10	59788877	critical splice acceptor site	probably null
R0645:Micu1	UTSW	10	59839681	missense	possibly damaging	0.95
R0988:Micu1	UTSW	10	59756727	intron	probably benign
R1121:Micu1	UTSW	10	59788982	missense	possibly damaging	0.50
R1334:Micu1	UTSW	10	59788976	missense	probably damaging	1.00
R1762:Micu1	UTSW	10	59863260	missense	possibly damaging	0.70
R1925:Micu1	UTSW	10	59733161	splice site	probably benign
R1976:Micu1	UTSW	10	59768213	missense	probably damaging	1.00
R2082:Micu1	UTSW	10	59863307	missense	probably benign	0.00
R2152:Micu1	UTSW	10	59863288	missense	probably benign	0.01
R2395:Micu1	UTSW	10	59863202	nonsense	probably null
R3619:Micu1	UTSW	10	59768258	splice site	probably null
R3953:Micu1	UTSW	10	59750504	missense	probably benign	0.01
R4809:Micu1	UTSW	10	59740822	missense	probably benign
R4948:Micu1	UTSW	10	59863254	missense	possibly damaging	0.56
R5103:Micu1	UTSW	10	59788984	missense	possibly damaging	0.79
R5137:Micu1	UTSW	10	59827232	missense	probably benign	0.20
R5431:Micu1	UTSW	10	59750521	missense	possibly damaging	0.92
R6910:Micu1	UTSW	10	59740667	missense	probably damaging	1.00
R7030:Micu1	UTSW	10	59789021	missense	possibly damaging	0.92
R7845:Micu1	UTSW	10	59839785	critical splice donor site	probably null
R7928:Micu1	UTSW	10	59839785	critical splice donor site	probably null
Z1177:Micu1	UTSW	10	59728041	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGGCCAGATTCATTTCTCCC -3'
(R):5'- CCATCGTTTTCAATCTGTGCAAG -3'

Sequencing Primer
(F):5'- ATTTCTCCCCTCAAACACAATTG -3'
(R):5'- CAAGAGACCTGGGGTTATTCTACC -3'

Posted On

2016-12-15