Incidental Mutation 'R5697:Smyd3'
ID450715
Institutional Source Beutler Lab
Gene Symbol Smyd3
Ensembl Gene ENSMUSG00000055067
Gene NameSET and MYND domain containing 3
Synonyms2410008A19Rik, Zmynd1
Accession Numbers

Genbank: NM_027188; MGI: 1916976; Ensembl: ENSMUST00000128302, ENSMUST00000111134, ENSMUST00000111133

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5697 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location178951960-179518041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 179411682 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 111 (K111T)
Ref Sequence ENSEMBL: ENSMUSP00000106764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111134] [ENSMUST00000128302]
Predicted Effect probably damaging
Transcript: ENSMUST00000111134
AA Change: K111T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106764
Gene: ENSMUSG00000055067
AA Change: K111T

DomainStartEndE-ValueType
Pfam:zf-MYND 40 87 2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128302
AA Change: K111T

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117410
Gene: ENSMUSG00000055067
AA Change: K111T

DomainStartEndE-ValueType
SET 4 246 1.04e-11 SMART
low complexity region 410 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone methyltransferase which functions in RNA polymerase II complexes by an interaction with a specific RNA helicase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Targeted, other(5) Gene trapped(29)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,991,673 F550S possibly damaging Het
Adamts15 G A 9: 30,911,794 T326I probably damaging Het
Akap9 T C 5: 3,960,170 L309P possibly damaging Het
Arfgef1 T C 1: 10,160,838 M1149V probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Capn9 C T 8: 124,589,071 H39Y unknown Het
Celsr2 G A 3: 108,403,921 Q1425* probably null Het
Chd6 A G 2: 161,018,051 L610P probably damaging Het
Clasp2 A T 9: 113,860,122 T424S probably benign Het
Clec5a T C 6: 40,582,270 D35G probably benign Het
Ctgf A G 10: 24,597,456 T298A probably benign Het
Dnhd1 T G 7: 105,674,188 V599G probably damaging Het
Enpep T C 3: 129,309,123 T395A probably benign Het
Evc2 G T 5: 37,370,608 L320F probably damaging Het
Fam129a T C 1: 151,700,261 F379L probably damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gm5346 A T 8: 43,626,579 W203R probably damaging Het
Hist1h2bp C T 13: 21,787,791 probably null Het
Hivep3 C T 4: 120,096,955 H823Y possibly damaging Het
Ighv1-59 C T 12: 115,335,348 E29K possibly damaging Het
Itsn1 A G 16: 91,801,589 I137V possibly damaging Het
Kntc1 A G 5: 123,765,007 T316A probably benign Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Megf6 G T 4: 154,258,229 A642S probably null Het
Mrgprb3 G T 7: 48,642,925 L293M probably damaging Het
Nes A G 3: 87,977,848 E1138G probably damaging Het
Pias2 A G 18: 77,133,188 K373R probably damaging Het
Prss23 A G 7: 89,509,982 F293S probably damaging Het
Pzp A G 6: 128,525,189 Y66H probably benign Het
Rnf213 A G 11: 119,483,894 R5061G possibly damaging Het
Sergef A G 7: 46,639,259 probably benign Het
Slc7a1 A G 5: 148,333,982 V558A probably benign Het
Smc2 A G 4: 52,459,045 E480G probably benign Het
Tchh A T 3: 93,445,043 R597* probably null Het
Ttc6 G T 12: 57,677,214 V1043L probably benign Het
Vmn1r10 T G 6: 57,113,489 L22R probably damaging Het
Vmn2r56 T C 7: 12,715,990 D107G probably damaging Het
Zfp365 A G 10: 67,909,640 Y103H probably benign Het
Zfp39 G T 11: 58,889,835 H700Q probably benign Het
Zfp982 A T 4: 147,512,589 E134D probably benign Het
Other mutations in Smyd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02044:Smyd3 APN 1 178972279 missense probably benign
IGL03088:Smyd3 APN 1 179094333 critical splice donor site probably null
D3080:Smyd3 UTSW 1 179086422 missense probably damaging 1.00
R0165:Smyd3 UTSW 1 179043872 missense probably benign
R0230:Smyd3 UTSW 1 179423428 splice site probably benign
R0390:Smyd3 UTSW 1 178957573 splice site probably benign
R1651:Smyd3 UTSW 1 179043876 missense probably benign
R4651:Smyd3 UTSW 1 179043741 missense probably benign 0.08
R4771:Smyd3 UTSW 1 179094396 missense probably damaging 0.99
R5326:Smyd3 UTSW 1 179410459 missense probably benign
R5542:Smyd3 UTSW 1 179410459 missense probably benign
R5850:Smyd3 UTSW 1 179043855 missense probably damaging 1.00
R6732:Smyd3 UTSW 1 179395830 missense probably benign 0.01
X0024:Smyd3 UTSW 1 179050289 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGACTATGCGTGTCACTGTC -3'
(R):5'- ATAGTTCTACTTAGGCTGTTAGGAG -3'

Sequencing Primer
(F):5'- GCGTGTCACTGTCATAAAGC -3'
(R):5'- CTGGTGATTCTCAGTGTTCAAAACCG -3'
Posted On2017-01-03