Incidental Mutation 'R5709:Sbno2'
ID452139
Institutional Source Beutler Lab
Gene Symbol Sbno2
Ensembl Gene ENSMUSG00000035673
Gene Namestrawberry notch 2
SynonymsStno
MMRRC Submission 043184-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R5709 (G1)
Quality Score172
Status Not validated
Chromosome10
Chromosomal Location80056992-80105571 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 80086337 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000151590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042771] [ENSMUST00000218630] [ENSMUST00000219258] [ENSMUST00000219260]
Predicted Effect probably null
Transcript: ENSMUST00000042771
AA Change: M1V

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041635
Gene: ENSMUSG00000035673
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
low complexity region 177 189 N/A INTRINSIC
Pfam:AAA_34 209 500 8.2e-135 PFAM
Pfam:ResIII 239 419 7.7e-8 PFAM
low complexity region 611 631 N/A INTRINSIC
Pfam:Helicase_C_4 726 1004 7.5e-120 PFAM
low complexity region 1263 1283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218462
Predicted Effect probably null
Transcript: ENSMUST00000218630
AA Change: M1V

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably null
Transcript: ENSMUST00000219258
AA Change: M1V

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably null
Transcript: ENSMUST00000219260
AA Change: M1V

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired osteoclast fusion, impaired osteoblastogenesis, osteopetrosis, increased bone mass, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Armt1 T G 10: 4,434,903 H39Q probably damaging Het
Car14 A T 3: 95,898,988 L284Q possibly damaging Het
Ccdc154 T C 17: 25,170,144 S437P probably damaging Het
Dpp9 C T 17: 56,189,393 V772I probably benign Het
Gm973 A T 1: 59,552,555 K366I possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Iglc2 T C 16: 19,198,634 T74A probably benign Het
Inhbb T A 1: 119,417,530 Y343F probably damaging Het
Krt13 C T 11: 100,117,643 G423R unknown Het
Lama3 T G 18: 12,539,799 M2483R probably damaging Het
Lrrc66 T C 5: 73,608,863 E279G probably benign Het
Matr3 A G 18: 35,581,962 E205G probably damaging Het
Mkks G A 2: 136,880,736 T167I probably benign Het
Mmp24 T A 2: 155,792,542 Y61N probably damaging Het
Nfkb2 A G 19: 46,310,521 T665A probably damaging Het
Nlrp3 G A 11: 59,555,748 W773* probably null Het
Olfr976 A T 9: 39,956,563 V136E probably damaging Het
Prol1 A T 5: 88,327,852 R34* probably null Het
Rcn1 T C 2: 105,394,783 Y109C probably damaging Het
Rint1 T G 5: 23,815,833 V618G probably damaging Het
Rtkn2 T A 10: 68,001,970 N117K probably benign Het
Shb T C 4: 45,458,327 E279G probably damaging Het
Smarcad1 A G 6: 65,074,762 D293G probably benign Het
Sohlh2 T C 3: 55,192,302 L165P probably benign Het
Spred2 T C 11: 20,021,415 C428R probably damaging Het
Stra8 A T 6: 34,927,762 D13V possibly damaging Het
Tdrd12 A G 7: 35,476,053 V976A probably damaging Het
Ttn A G 2: 76,943,387 S2297P unknown Het
Ttn A G 2: 76,894,658 probably null Het
Usp1 A G 4: 98,931,123 D274G probably damaging Het
Vmn1r4 A G 6: 56,956,619 K36R probably benign Het
Zfp386 T A 12: 116,059,685 I306N probably benign Het
Zmpste24 T C 4: 121,065,878 D380G probably benign Het
Other mutations in Sbno2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Sbno2 APN 10 80064506 splice site probably benign
IGL01773:Sbno2 APN 10 80057831 missense probably damaging 1.00
IGL01869:Sbno2 APN 10 80060392 critical splice donor site probably null
IGL01911:Sbno2 APN 10 80069624 nonsense probably null
IGL02071:Sbno2 APN 10 80060641 missense probably damaging 1.00
IGL02094:Sbno2 APN 10 80057645 missense probably benign
IGL02220:Sbno2 APN 10 80072368 missense probably benign 0.04
IGL02366:Sbno2 APN 10 80064202 missense probably damaging 1.00
IGL02608:Sbno2 APN 10 80067402 splice site probably null
IGL03007:Sbno2 APN 10 80058550 splice site probably benign
IGL03083:Sbno2 APN 10 80057534 missense probably damaging 0.98
IGL03393:Sbno2 APN 10 80066901 missense probably damaging 1.00
R0034:Sbno2 UTSW 10 80058340 splice site probably benign
R0126:Sbno2 UTSW 10 80068853 splice site probably null
R0652:Sbno2 UTSW 10 80067294 missense probably damaging 1.00
R0964:Sbno2 UTSW 10 80084259 missense possibly damaging 0.75
R1571:Sbno2 UTSW 10 80060392 critical splice donor site probably null
R1601:Sbno2 UTSW 10 80060492 missense probably damaging 0.98
R1634:Sbno2 UTSW 10 80060634 missense possibly damaging 0.73
R1733:Sbno2 UTSW 10 80058508 missense possibly damaging 0.92
R1762:Sbno2 UTSW 10 80066606 missense probably damaging 1.00
R1832:Sbno2 UTSW 10 80060605 nonsense probably null
R1859:Sbno2 UTSW 10 80058639 nonsense probably null
R2086:Sbno2 UTSW 10 80057856 missense possibly damaging 0.89
R2136:Sbno2 UTSW 10 80062693 missense probably damaging 1.00
R2360:Sbno2 UTSW 10 80058021 missense possibly damaging 0.81
R4426:Sbno2 UTSW 10 80072358 missense probably null 0.02
R4504:Sbno2 UTSW 10 80060492 missense possibly damaging 0.46
R4692:Sbno2 UTSW 10 80086327 missense possibly damaging 0.90
R5044:Sbno2 UTSW 10 80062188 missense probably benign 0.11
R5166:Sbno2 UTSW 10 80066928 nonsense probably null
R5576:Sbno2 UTSW 10 80067337 missense probably damaging 0.99
R5665:Sbno2 UTSW 10 80058453 missense probably benign 0.00
R5828:Sbno2 UTSW 10 80066590 missense possibly damaging 0.84
R6192:Sbno2 UTSW 10 80060016 missense probably damaging 0.99
R6971:Sbno2 UTSW 10 80060034 missense possibly damaging 0.95
R7012:Sbno2 UTSW 10 80069518 intron probably benign
R7082:Sbno2 UTSW 10 80060090 splice site probably null
R7133:Sbno2 UTSW 10 80086312 missense probably damaging 1.00
R7438:Sbno2 UTSW 10 80069575 missense unknown
R7481:Sbno2 UTSW 10 80057499 missense probably benign 0.11
R7746:Sbno2 UTSW 10 80058874 missense probably damaging 0.99
R7964:Sbno2 UTSW 10 80068351 missense probably damaging 1.00
R8055:Sbno2 UTSW 10 80069431 missense possibly damaging 0.81
R8221:Sbno2 UTSW 10 80070011 missense probably benign
R8329:Sbno2 UTSW 10 80064387 missense probably damaging 1.00
X0026:Sbno2 UTSW 10 80057459 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGCCCTCAAGAAATCTGCTC -3'
(R):5'- CACTTTCCAGATAGGCTTGCCG -3'

Sequencing Primer
(F):5'- TCAAGAAATCTGCTCTGGGGC -3'
(R):5'- AGATAGGCTTGCCGGGAGTTG -3'
Posted On2017-01-03