Incidental Mutation 'R5871:Sec14l5'
ID455208
Institutional Source Beutler Lab
Gene Symbol Sec14l5
Ensembl Gene ENSMUSG00000091712
Gene NameSEC14-like lipid binding 5
Synonyms
MMRRC Submission 043234-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R5871 (G1)
Quality Score184
Status Not validated
Chromosome16
Chromosomal Location5147109-5187271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5168853 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 168 (N168K)
Ref Sequence ENSEMBL: ENSMUSP00000155164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165810] [ENSMUST00000230616]
Predicted Effect probably benign
Transcript: ENSMUST00000165810
AA Change: N168K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128063
Gene: ENSMUSG00000091712
AA Change: N168K

DomainStartEndE-ValueType
Pfam:PRELI 17 173 4.2e-52 PFAM
CRAL_TRIO_N 263 288 1.05e-4 SMART
SEC14 306 479 1.59e-58 SMART
low complexity region 496 510 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230616
AA Change: N168K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A T 1: 173,332,073 L293Q probably damaging Het
Ankrd13d A G 19: 4,281,994 V92A possibly damaging Het
Anxa5 T A 3: 36,452,249 Q218L possibly damaging Het
Bend6 T C 1: 33,863,865 M135V probably damaging Het
Ccr5 T C 9: 124,124,521 F54L probably benign Het
Chrng T C 1: 87,206,729 V164A possibly damaging Het
Clca3a1 T G 3: 144,754,881 S271R probably damaging Het
Csmd3 G A 15: 47,888,716 T1282I probably damaging Het
Dock10 C A 1: 80,541,340 probably null Het
Esrrb A G 12: 86,505,887 Y196C probably benign Het
Fam76a T C 4: 132,904,010 D208G probably damaging Het
Fancd2 A G 6: 113,556,282 E520G probably benign Het
Fgf9 A T 14: 58,083,199 probably null Het
Gatb T A 3: 85,653,776 L533* probably null Het
Gm884 T C 11: 103,616,454 probably benign Het
Igsf10 G T 3: 59,330,411 A783D possibly damaging Het
Ldlrap1 A G 4: 134,758,929 I73T probably damaging Het
Msr1 G A 8: 39,611,652 P327L probably damaging Het
Myo18a T C 11: 77,832,480 Y823H probably damaging Het
Ncapg A G 5: 45,695,697 E835G probably damaging Het
Nfam1 A G 15: 83,016,422 S120P probably damaging Het
Olfr1158 T C 2: 87,991,011 F300S possibly damaging Het
Olfr1294 A G 2: 111,537,639 S217P probably damaging Het
Olfr679 T C 7: 105,086,304 V196A possibly damaging Het
Olfr913 T A 9: 38,594,332 I37K possibly damaging Het
Phtf2 A G 5: 20,794,401 V248A probably benign Het
Pik3r3 G T 4: 116,286,158 E283* probably null Het
Plcg2 T A 8: 117,504,217 Y13N probably damaging Het
Pth2r C T 1: 65,388,637 P490S probably damaging Het
Rnf40 T A 7: 127,591,585 M275K probably damaging Het
Rpgrip1l T C 8: 91,221,386 E1223G possibly damaging Het
Siglecf T C 7: 43,355,621 V425A probably benign Het
Sorbs1 A G 19: 40,398,583 V13A probably damaging Het
Svil T A 18: 5,103,669 probably null Het
Tbrg1 A G 9: 37,650,982 I300T probably damaging Het
Tnni3k T A 3: 155,030,370 D112V probably benign Het
Ubxn1 A G 19: 8,874,212 Q203R probably benign Het
Ugt1a7c A G 1: 88,095,659 D180G possibly damaging Het
Usp14 A G 18: 9,996,234 F449L probably benign Het
Wwc2 A G 8: 47,868,423 L552P unknown Het
Zscan10 A G 17: 23,607,267 probably benign Het
Other mutations in Sec14l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Sec14l5 APN 16 5178630 critical splice donor site probably null
R0226:Sec14l5 UTSW 16 5180303 missense probably benign 0.18
R0333:Sec14l5 UTSW 16 5167066 missense probably damaging 1.00
R0370:Sec14l5 UTSW 16 5180706 missense probably damaging 1.00
R0581:Sec14l5 UTSW 16 5178485 splice site probably null
R2109:Sec14l5 UTSW 16 5167104 nonsense probably null
R2230:Sec14l5 UTSW 16 5176481 missense probably damaging 1.00
R2944:Sec14l5 UTSW 16 5180833 missense probably benign 0.05
R3001:Sec14l5 UTSW 16 5171882 missense probably damaging 1.00
R3002:Sec14l5 UTSW 16 5171882 missense probably damaging 1.00
R3409:Sec14l5 UTSW 16 5165654 splice site probably null
R3432:Sec14l5 UTSW 16 5178599 missense possibly damaging 0.55
R3913:Sec14l5 UTSW 16 5147856 splice site probably benign
R4941:Sec14l5 UTSW 16 5176500 missense probably damaging 1.00
R5468:Sec14l5 UTSW 16 5167140 splice site probably null
R5474:Sec14l5 UTSW 16 5178518 missense possibly damaging 0.74
R6226:Sec14l5 UTSW 16 5176565 missense probably damaging 0.99
R6315:Sec14l5 UTSW 16 5180277 missense possibly damaging 0.81
R6333:Sec14l5 UTSW 16 5167044 missense probably benign 0.00
R6360:Sec14l5 UTSW 16 5172995 missense probably damaging 0.99
R7426:Sec14l5 UTSW 16 5180875 missense probably damaging 1.00
X0064:Sec14l5 UTSW 16 5176102 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCGATGCTTTACCAATGTGAAG -3'
(R):5'- CAGACCTACCATCCGCTATG -3'

Sequencing Primer
(F):5'- TGTGAAGCTAAGCTCACTGC -3'
(R):5'- CTATGGCCATCTCAGAAGCAGG -3'
Posted On2017-02-10