Incidental Mutation 'R5891:Coro1c'
ID457168
Institutional Source Beutler Lab
Gene Symbol Coro1c
Ensembl Gene ENSMUSG00000004530
Gene Namecoronin, actin binding protein 1C
Synonymscoronin 3
MMRRC Submission 044092-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5891 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location113842436-113908758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113850811 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 157 (I157T)
Ref Sequence ENSEMBL: ENSMUSP00000004646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004646] [ENSMUST00000164980]
Predicted Effect probably damaging
Transcript: ENSMUST00000004646
AA Change: I157T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004646
Gene: ENSMUSG00000004530
AA Change: I157T

DomainStartEndE-ValueType
DUF1899 3 67 2.53e-36 SMART
WD40 66 109 3.99e-8 SMART
WD40 119 159 1.09e-5 SMART
WD40 162 202 3.09e-5 SMART
DUF1900 256 390 4.5e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163995
Predicted Effect probably benign
Transcript: ENSMUST00000164980
SMART Domains Protein: ENSMUSP00000129314
Gene: ENSMUSG00000004530

DomainStartEndE-ValueType
DUF1899 3 67 2.53e-36 SMART
WD40 66 109 3.99e-8 SMART
Pfam:WD40 120 149 8e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172016
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 96% (85/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,589 I828V probably benign Het
A430105I19Rik T A 2: 118,761,383 D92V probably damaging Het
Abi3bp A T 16: 56,606,133 T504S probably damaging Het
Adamtsl4 C A 3: 95,682,313 R387L possibly damaging Het
Adgb G A 10: 10,377,847 Q1224* probably null Het
Ankrd40 T A 11: 94,334,863 F240Y probably damaging Het
Asnsd1 A T 1: 53,347,977 Y164N probably benign Het
Atf7ip A T 6: 136,559,977 E69D possibly damaging Het
Atm T C 9: 53,497,159 T1129A probably benign Het
AU021092 T C 16: 5,212,131 D340G probably benign Het
Baz2a T A 10: 128,121,322 I978N probably damaging Het
BC034090 T C 1: 155,233,047 probably benign Het
Bcl9 A G 3: 97,208,888 L830P probably damaging Het
Bicral T C 17: 46,801,229 N1015S probably benign Het
Ceacam3 C A 7: 17,151,793 T107N probably damaging Het
Cep83 T C 10: 94,725,675 V109A probably benign Het
Ces1e A G 8: 93,203,266 V463A possibly damaging Het
Ciao1 A G 2: 127,247,134 V55A probably benign Het
Col19a1 T C 1: 24,289,725 E900G probably damaging Het
Commd3 A G 2: 18,673,815 probably benign Het
Ctso T A 3: 81,954,254 F311L probably benign Het
Cxcl10 A G 5: 92,348,224 probably benign Het
Daam1 C A 12: 71,944,149 T179N unknown Het
Ddx24 T C 12: 103,424,058 K225E probably damaging Het
Dnajc16 T C 4: 141,775,392 T278A probably benign Het
Dnajc2 A T 5: 21,761,711 N345K possibly damaging Het
Dnpep G T 1: 75,311,812 Q395K probably benign Het
Dync1h1 T C 12: 110,614,220 probably null Het
Exoc1 A G 5: 76,542,144 D177G probably damaging Het
Fam135b C T 15: 71,525,803 R136H probably damaging Het
Fam214a C G 9: 75,004,386 C46W probably damaging Het
Filip1 T G 9: 79,819,860 L492F possibly damaging Het
Flvcr2 A T 12: 85,796,228 I359F possibly damaging Het
Gmcl1 A G 6: 86,707,443 W366R probably damaging Het
Htt A G 5: 34,870,823 T1808A possibly damaging Het
Ighv5-4 C A 12: 113,597,629 R57L probably damaging Het
Il12rb2 A T 6: 67,360,690 I69N probably damaging Het
Irf5 A T 6: 29,529,425 probably benign Het
Kif13b T G 14: 64,788,405 probably null Het
Klkb1 T A 8: 45,270,666 T571S probably benign Het
Mapkbp1 G T 2: 120,023,932 E1337* probably null Het
Met A G 6: 17,491,539 D100G probably benign Het
Mgam T A 6: 40,744,348 D183E probably benign Het
Mrgprb13 T C 7: 48,312,259 noncoding transcript Het
Mrgprx2 T C 7: 48,482,246 T275A probably benign Het
Mroh2a C A 1: 88,241,615 Q671K possibly damaging Het
Nckipsd T A 9: 108,808,609 S42R probably damaging Het
Nlrp12 T A 7: 3,219,259 probably benign Het
Olfr1297 A T 2: 111,621,433 L214M probably damaging Het
Olfr361 T A 2: 37,084,978 M257L probably benign Het
Olfr467 C T 7: 107,815,180 P199S probably damaging Het
Olfr527 C T 7: 140,336,600 T246I probably benign Het
Otoa T A 7: 121,132,360 probably null Het
Pfkm T A 15: 98,122,690 C233* probably null Het
Pikfyve A G 1: 65,202,737 Y212C probably damaging Het
Ptprq T A 10: 107,576,895 D1781V possibly damaging Het
Pttg1ip A G 10: 77,582,440 probably benign Het
Rab6a T A 7: 100,639,247 probably null Het
Rbm11 C T 16: 75,598,837 A132V possibly damaging Het
Sept4 G T 11: 87,588,924 probably benign Het
Serpinb8 A G 1: 107,605,845 E210G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slco5a1 A G 1: 12,990,402 F32L probably benign Het
Smad2 A G 18: 76,299,975 E326G probably damaging Het
Sp9 T A 2: 73,274,251 L383Q probably damaging Het
Stx11 T C 10: 12,941,815 N55S probably damaging Het
Tbc1d15 T A 10: 115,220,308 Q253L probably benign Het
Tcf7l1 T A 6: 72,637,051 probably benign Het
Tdrd9 T A 12: 112,042,719 S1020T probably damaging Het
Tead3 A T 17: 28,341,365 D88E probably damaging Het
Tnrc18 A G 5: 142,815,171 S11P probably damaging Homo
Trpc3 G T 3: 36,671,022 D268E probably damaging Het
Ttn A G 2: 76,745,741 V23190A possibly damaging Het
Ubr4 T A 4: 139,408,626 Y908* probably null Het
Urb2 G T 8: 124,030,856 V1101L possibly damaging Het
Usp9y A T Y: 1,341,535 D1375E probably benign Het
Zcchc7 T C 4: 44,895,838 L262P probably damaging Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Zfp518a T A 19: 40,912,433 C269S probably damaging Het
Zfp933 T C 4: 147,826,774 K90E probably benign Het
Other mutations in Coro1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Coro1c APN 5 113849614 missense probably benign 0.07
IGL01138:Coro1c APN 5 113852161 splice site probably benign
IGL01474:Coro1c APN 5 113882155 splice site probably benign
IGL02075:Coro1c APN 5 113844393 missense probably damaging 1.00
IGL02106:Coro1c APN 5 113852273 missense probably benign 0.01
IGL02831:Coro1c APN 5 113844408 missense probably benign
R0254:Coro1c UTSW 5 113845252 missense probably benign 0.09
R0975:Coro1c UTSW 5 113882121 missense probably damaging 1.00
R1835:Coro1c UTSW 5 113848543 missense probably benign 0.10
R2944:Coro1c UTSW 5 113850800 missense probably damaging 1.00
R5210:Coro1c UTSW 5 113845306 missense probably damaging 1.00
R5354:Coro1c UTSW 5 113846165 missense possibly damaging 0.94
R5379:Coro1c UTSW 5 113845382 missense probably damaging 1.00
R5414:Coro1c UTSW 5 113848546 missense possibly damaging 0.55
R5869:Coro1c UTSW 5 113850846 intron probably benign
R7037:Coro1c UTSW 5 113845396 missense possibly damaging 0.60
R7116:Coro1c UTSW 5 113852206 nonsense probably null
R7536:Coro1c UTSW 5 113845289 missense probably damaging 1.00
X0018:Coro1c UTSW 5 113848594 missense probably benign 0.13
Z1088:Coro1c UTSW 5 113850649 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCTGTGTGGCAGCCTTCAG -3'
(R):5'- ATTTACAGAGATCACATCACTCCAG -3'

Sequencing Primer
(F):5'- CCTTCAGAGCCCAGGAAAGG -3'
(R):5'- GATCACATCACTCCAGCCTAGTAGG -3'
Posted On2017-02-15