Incidental Mutation 'R5917:Olfr13'
ID461388
Institutional Source Beutler Lab
Gene Symbol Olfr13
Ensembl Gene ENSMUSG00000043605
Gene Nameolfactory receptor 13
SynonymsMOR261-6, GA_x6K02T2P3E9-4384160-4383228
MMRRC Submission 044114-MU
Accession Numbers

Genbank: NM_146652; MGI: 104812

Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R5917 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location43172140-43177460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43174712 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 242 (S242F)
Ref Sequence ENSEMBL: ENSMUSP00000149893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059512] [ENSMUST00000205175] [ENSMUST00000216179]
Predicted Effect probably damaging
Transcript: ENSMUST00000059512
AA Change: S242F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053813
Gene: ENSMUSG00000043605
AA Change: S242F

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4.8e-60 PFAM
Pfam:7TM_GPCR_Srsx 34 218 1.3e-6 PFAM
Pfam:7tm_1 40 289 6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205175
SMART Domains Protein: ENSMUSP00000145490
Gene: ENSMUSG00000071481

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.5e-60 PFAM
Pfam:7tm_1 40 289 3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216179
AA Change: S242F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Amdhd1 T C 10: 93,524,470 H409R possibly damaging Het
Anks1b C T 10: 90,576,941 probably benign Het
Ascc2 T C 11: 4,681,506 L649P probably benign Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Cryz T A 3: 154,621,766 S144T probably benign Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dact1 G T 12: 71,318,682 V746L possibly damaging Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Il31ra A G 13: 112,546,312 C87R probably benign Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Lgi4 C T 7: 31,060,178 T53M possibly damaging Het
Limk1 A G 5: 134,657,935 F533L probably damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Mmrn1 T C 6: 60,973,150 probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Proc T A 18: 32,127,460 D204V probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Tle3 A G 9: 61,408,908 D296G probably benign Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp521 T A 18: 13,845,555 K600N probably damaging Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Olfr13
AlleleSourceChrCoordTypePredicted EffectPPH Score
N/A - 293:Olfr13 UTSW 6 43174559 missense probably benign 0.45
R0279:Olfr13 UTSW 6 43174758 missense probably benign 0.03
R0594:Olfr13 UTSW 6 43174607 missense possibly damaging 0.64
R0669:Olfr13 UTSW 6 43174004 missense probably benign 0.36
R1339:Olfr13 UTSW 6 43174610 missense probably benign 0.39
R1371:Olfr13 UTSW 6 43174300 missense probably benign 0.01
R1669:Olfr13 UTSW 6 43174821 missense probably damaging 1.00
R1832:Olfr13 UTSW 6 43174900 missense probably benign
R2136:Olfr13 UTSW 6 43174501 missense probably benign
R4358:Olfr13 UTSW 6 43174226 missense probably damaging 0.97
R4755:Olfr13 UTSW 6 43174043 missense probably benign 0.00
R4933:Olfr13 UTSW 6 43174321 missense probably benign 0.22
R5504:Olfr13 UTSW 6 43174638 nonsense probably null
R5677:Olfr13 UTSW 6 43174331 missense probably benign 0.35
R6287:Olfr13 UTSW 6 43174435 missense probably benign 0.00
R6480:Olfr13 UTSW 6 43174066 missense probably benign 0.05
R7020:Olfr13 UTSW 6 43174162 missense possibly damaging 0.91
R7240:Olfr13 UTSW 6 43174501 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGTGTCTCAGAAAGTGAACC -3'
(R):5'- AAGCTCTCTGTGTCCTCAGC -3'

Sequencing Primer
(F):5'- AGCTATCCTCAAACTTGCCTGTG -3'
(R):5'- GTGTCCTCAGCACTCTTTTCAATG -3'
Posted On2017-02-28