Incidental Mutation 'R5917:Lgi4'
ID461393
Institutional Source Beutler Lab
Gene Symbol Lgi4
Ensembl Gene ENSMUSG00000036560
Gene Nameleucine-rich repeat LGI family, member 4
Synonymsclp
MMRRC Submission 044114-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5917 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location31059342-31070935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31060178 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 53 (T53M)
Ref Sequence ENSEMBL: ENSMUSP00000041579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039775] [ENSMUST00000039909] [ENSMUST00000164725] [ENSMUST00000169785] [ENSMUST00000205439] [ENSMUST00000205807] [ENSMUST00000206305] [ENSMUST00000206328] [ENSMUST00000206474]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039775
AA Change: T53M

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041579
Gene: ENSMUSG00000036560
AA Change: T53M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
LRR 75 98 7.17e1 SMART
LRR 99 122 2.76e1 SMART
LRR_TYP 123 146 2.43e-4 SMART
LRRCT 158 207 3.97e-5 SMART
Pfam:EPTP 214 251 1.1e-7 PFAM
Pfam:EPTP 396 438 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039909
SMART Domains Protein: ENSMUSP00000048460
Gene: ENSMUSG00000036570

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 23 72 1.1e-31 PFAM
low complexity region 81 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164725
Predicted Effect probably benign
Transcript: ENSMUST00000169785
Predicted Effect probably benign
Transcript: ENSMUST00000172001
SMART Domains Protein: ENSMUSP00000125865
Gene: ENSMUSG00000036560

DomainStartEndE-ValueType
LRRCT 9 58 3.97e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205392
Predicted Effect probably benign
Transcript: ENSMUST00000205439
Predicted Effect probably benign
Transcript: ENSMUST00000205807
Predicted Effect probably benign
Transcript: ENSMUST00000206305
Predicted Effect probably benign
Transcript: ENSMUST00000206328
Predicted Effect probably benign
Transcript: ENSMUST00000206474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206522
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant animals have an abnormal posture where the forelimbs are flexed and rotated inwards. The peripheral nervous system is delayed in myelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Amdhd1 T C 10: 93,524,470 H409R possibly damaging Het
Anks1b C T 10: 90,576,941 probably benign Het
Ascc2 T C 11: 4,681,506 L649P probably benign Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Cryz T A 3: 154,621,766 S144T probably benign Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dact1 G T 12: 71,318,682 V746L possibly damaging Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Il31ra A G 13: 112,546,312 C87R probably benign Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Limk1 A G 5: 134,657,935 F533L probably damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Mmrn1 T C 6: 60,973,150 probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr13 C T 6: 43,174,712 S242F probably damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Proc T A 18: 32,127,460 D204V probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Tle3 A G 9: 61,408,908 D296G probably benign Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp521 T A 18: 13,845,555 K600N probably damaging Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Lgi4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lgi4 APN 7 31069043 missense probably benign 0.01
IGL01624:Lgi4 APN 7 31067688 missense probably damaging 1.00
IGL02251:Lgi4 APN 7 31067263 splice site probably null
IGL02755:Lgi4 APN 7 31063105 missense probably damaging 1.00
IGL03153:Lgi4 APN 7 31060558 missense probably damaging 1.00
IGL03392:Lgi4 APN 7 31063180 splice site probably null
R0060:Lgi4 UTSW 7 31063571 missense probably damaging 0.97
R0575:Lgi4 UTSW 7 31060093 missense probably benign 0.12
R2139:Lgi4 UTSW 7 31063123 missense probably damaging 1.00
R2276:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2277:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2278:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2939:Lgi4 UTSW 7 31067828 nonsense probably null
R3039:Lgi4 UTSW 7 31060067 missense probably benign
R3922:Lgi4 UTSW 7 31067448 missense probably benign
R4650:Lgi4 UTSW 7 31069129 missense probably benign 0.38
R5184:Lgi4 UTSW 7 31070757 unclassified probably benign
R5583:Lgi4 UTSW 7 31061137 missense possibly damaging 0.92
R5837:Lgi4 UTSW 7 31070783 unclassified probably benign
R6198:Lgi4 UTSW 7 31069122 unclassified probably null
R6454:Lgi4 UTSW 7 31060132 missense probably benign
R6845:Lgi4 UTSW 7 31061085 missense probably damaging 0.99
R6897:Lgi4 UTSW 7 31068890 missense probably benign 0.00
R7232:Lgi4 UTSW 7 31067351 missense possibly damaging 0.67
R7354:Lgi4 UTSW 7 31060622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCACGGAGATGTAGTGATTTGG -3'
(R):5'- TACACATGTGGCCAAGGTCC -3'

Sequencing Primer
(F):5'- CTGGCAGTGTGGGGACAG -3'
(R):5'- CCAAATCCTGGAGTCTCA -3'
Posted On2017-02-28