Incidental Mutation 'R3922:Lgi4'
ID353164
Institutional Source Beutler Lab
Gene Symbol Lgi4
Ensembl Gene ENSMUSG00000036560
Gene Nameleucine-rich repeat LGI family, member 4
Synonymsclp
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3922 (G1)
Quality Score78
Status Validated
Chromosome7
Chromosomal Location31059342-31070935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31067448 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 300 (D300V)
Ref Sequence ENSEMBL: ENSMUSP00000041579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039775] [ENSMUST00000072331] [ENSMUST00000164725] [ENSMUST00000167369] [ENSMUST00000169785] [ENSMUST00000171359]
Predicted Effect probably benign
Transcript: ENSMUST00000039775
AA Change: D300V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041579
Gene: ENSMUSG00000036560
AA Change: D300V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
LRR 75 98 7.17e1 SMART
LRR 99 122 2.76e1 SMART
LRR_TYP 123 146 2.43e-4 SMART
LRRCT 158 207 3.97e-5 SMART
Pfam:EPTP 214 251 1.1e-7 PFAM
Pfam:EPTP 396 438 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072331
Predicted Effect probably benign
Transcript: ENSMUST00000072331
Predicted Effect probably benign
Transcript: ENSMUST00000164725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165862
Predicted Effect probably benign
Transcript: ENSMUST00000167369
SMART Domains Protein: ENSMUSP00000130245
Gene: ENSMUSG00000057092

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 25 71 5.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169424
Predicted Effect probably benign
Transcript: ENSMUST00000169785
Predicted Effect probably benign
Transcript: ENSMUST00000171359
SMART Domains Protein: ENSMUSP00000128610
Gene: ENSMUSG00000057092

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 23 72 4.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172001
SMART Domains Protein: ENSMUSP00000125865
Gene: ENSMUSG00000036560

DomainStartEndE-ValueType
LRRCT 9 58 3.97e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186929
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Homozygous mutant animals have an abnormal posture where the forelimbs are flexed and rotated inwards. The peripheral nervous system is delayed in myelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Lgi4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lgi4 APN 7 31069043 missense probably benign 0.01
IGL01624:Lgi4 APN 7 31067688 missense probably damaging 1.00
IGL02251:Lgi4 APN 7 31067263 splice site probably null
IGL02755:Lgi4 APN 7 31063105 missense probably damaging 1.00
IGL03153:Lgi4 APN 7 31060558 missense probably damaging 1.00
IGL03392:Lgi4 APN 7 31063180 splice site probably null
R0060:Lgi4 UTSW 7 31063571 missense probably damaging 0.97
R0575:Lgi4 UTSW 7 31060093 missense probably benign 0.12
R2139:Lgi4 UTSW 7 31063123 missense probably damaging 1.00
R2276:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2277:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2278:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2939:Lgi4 UTSW 7 31067828 nonsense probably null
R3039:Lgi4 UTSW 7 31060067 missense probably benign
R4650:Lgi4 UTSW 7 31069129 missense probably benign 0.38
R5184:Lgi4 UTSW 7 31070757 unclassified probably benign
R5583:Lgi4 UTSW 7 31061137 missense possibly damaging 0.92
R5837:Lgi4 UTSW 7 31070783 unclassified probably benign
R5917:Lgi4 UTSW 7 31060178 missense possibly damaging 0.76
R6198:Lgi4 UTSW 7 31069122 unclassified probably null
R6454:Lgi4 UTSW 7 31060132 missense probably benign
R6845:Lgi4 UTSW 7 31061085 missense probably damaging 0.99
R6897:Lgi4 UTSW 7 31068890 missense probably benign 0.00
R7232:Lgi4 UTSW 7 31067351 missense possibly damaging 0.67
R7354:Lgi4 UTSW 7 31060622 missense probably damaging 1.00
R8224:Lgi4 UTSW 7 31063592 missense probably damaging 1.00
R8257:Lgi4 UTSW 7 31067341 critical splice acceptor site probably null
R8320:Lgi4 UTSW 7 31068941 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGATCCTGGTGTGGGACTACAG -3'
(R):5'- TGAAAGAGCACAGGCCTCTG -3'

Sequencing Primer
(F):5'- TGTGGGACTACAGCCTGCAAC -3'
(R):5'- CCTCTGGGAGGCTGAAGCAAG -3'
Posted On2015-10-19