Incidental Mutation 'R5921:Gal'
ID461611
Institutional Source Beutler Lab
Gene Symbol Gal
Ensembl Gene ENSMUSG00000024907
Gene Namegalanin
SynonymsGaln
MMRRC Submission 044118-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5921 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3409919-3414472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3410100 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 124 (S124P)
Ref Sequence ENSEMBL: ENSMUSP00000025842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025840] [ENSMUST00000025842] [ENSMUST00000127142] [ENSMUST00000142193]
Predicted Effect probably benign
Transcript: ENSMUST00000025840
SMART Domains Protein: ENSMUSP00000025840
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
low complexity region 91 99 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Blast:CXC 246 287 4e-13 BLAST
CXC 332 373 1.37e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000025842
AA Change: S124P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025842
Gene: ENSMUSG00000024907
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Galanin 20 124 3.41e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127142
SMART Domains Protein: ENSMUSP00000122687
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142193
SMART Domains Protein: ENSMUSP00000114171
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Meta Mutation Damage Score 0.1777 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: This gene encodes a neuroendocrine peptide that is principally produced by a subpopulation of lactotrophs in the pituitary gland. The encoded protein is a precursor that is proteolytically processed to generate two mature peptides: galanin and galanin message-associated peptide (GMAP). Mice lacking the encoded protein fail to lactate sufficiently due to abnormalities in the expression of prolactin and lactotroph proliferation, exhibit attenuated chronic neuropathic pain and developmental deficits in the dorsal root ganglion neurons. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature proteins. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to alterations in neuroendocrine homeostasis, prolactin release, lactotroph number, mammary gland maturation, lactation, susceptibility to neuronal excitotoxicity and induced seizures, sensory neuron developmentand regeneration, and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik G T 8: 13,734,840 A34S probably damaging Het
Ablim2 G A 5: 35,812,211 V223M probably damaging Het
Adamts7 T C 9: 90,188,694 S623P probably benign Het
Aqp7 G T 4: 41,036,093 N48K probably benign Het
Asic4 A G 1: 75,451,373 N181S probably benign Het
Blvra A T 2: 127,087,363 probably benign Het
Bmf C A 2: 118,532,553 probably benign Het
Bnc2 A T 4: 84,293,055 I454N possibly damaging Het
Catsperg1 A T 7: 29,190,523 L700H possibly damaging Het
Ccdc14 T C 16: 34,706,391 V222A probably damaging Het
Clstn3 A T 6: 124,431,580 probably benign Het
Col15a1 A T 4: 47,300,602 I1066F probably damaging Het
Dcdc2c T C 12: 28,524,775 E116G possibly damaging Het
Dopey1 G A 9: 86,501,922 S310N probably damaging Het
Dync1h1 T A 12: 110,618,368 V735E probably damaging Het
Eva1a T C 6: 82,092,159 Y156H probably damaging Het
Fbxw26 A G 9: 109,746,018 I13T probably damaging Het
Fermt2 A T 14: 45,464,746 L527Q probably damaging Het
Fxyd4 G A 6: 117,936,138 probably benign Het
Glmp T C 3: 88,325,976 S56P probably benign Het
Gm5600 T C 7: 113,708,176 noncoding transcript Het
Golga2 A G 2: 32,297,755 N194S probably benign Het
Gon4l T C 3: 88,909,947 probably benign Het
Gtf2ird2 T A 5: 134,217,584 Y895N probably damaging Het
Hsd3b1 C A 3: 98,857,899 M22I probably benign Het
Ipo13 A C 4: 117,912,089 L169V probably benign Het
Kif13a G T 13: 46,825,300 T208K probably damaging Het
Klhl5 G T 5: 65,162,956 A618S probably damaging Het
Lrig2 A T 3: 104,462,754 L496* probably null Het
Macf1 A G 4: 123,526,711 I250T probably benign Het
Man1a A G 10: 53,907,510 I632T probably damaging Het
Nav2 A G 7: 49,304,576 probably benign Het
Nek8 A G 11: 78,173,059 M40T probably damaging Het
Oas3 T C 5: 120,769,981 D298G probably damaging Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr115 A T 17: 37,610,219 C177* probably null Het
Olfr12 T A 1: 92,620,622 S239T probably benign Het
Olfr284 T C 15: 98,340,429 T187A probably benign Het
Pafah2 G T 4: 134,418,069 V255L probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Pirb A C 7: 3,716,694 Y484* probably null Het
Prl8a6 A G 13: 27,437,188 S20P probably damaging Het
R3hdm4 A T 10: 79,913,619 V52E probably damaging Het
Rab3ip A G 10: 116,939,247 Y69H probably damaging Het
Rxrg T C 1: 167,639,239 M330T possibly damaging Het
Sema4g G T 19: 44,998,704 G460V probably benign Het
Sidt1 T C 16: 44,273,735 probably benign Het
Slc12a2 T A 18: 57,932,523 D943E probably benign Het
Slc12a4 T C 8: 105,945,244 probably null Het
Slc4a3 T G 1: 75,557,444 probably null Het
Slc4a8 C T 15: 100,814,447 probably benign Het
Srcap T A 7: 127,558,833 probably benign Het
Stk39 A G 2: 68,366,105 S327P probably damaging Het
Tbc1d5 G A 17: 50,963,693 T170M probably damaging Het
Trim13 T A 14: 61,605,089 F185Y probably benign Het
Ttc17 A G 2: 94,378,848 V87A probably damaging Het
Ttn A T 2: 76,720,863 M31395K possibly damaging Het
Usp34 T A 11: 23,464,686 D2876E probably damaging Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn2r93 T A 17: 18,325,768 L634Q probably damaging Het
Vmp1 C T 11: 86,586,510 A355T probably benign Het
Xpo5 A T 17: 46,221,421 M461L probably benign Het
Zfp759 T A 13: 67,140,494 F703Y probably damaging Het
Other mutations in Gal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Gal APN 19 3411575 missense probably benign 0.02
R0385:Gal UTSW 19 3411171 missense probably benign 0.13
R3605:Gal UTSW 19 3414026 splice site probably null
R4817:Gal UTSW 19 3411126 splice site probably null
R4911:Gal UTSW 19 3411590 missense probably benign 0.15
R5046:Gal UTSW 19 3411167 missense probably damaging 0.99
R6660:Gal UTSW 19 3410108 missense possibly damaging 0.52
R7658:Gal UTSW 19 3413309 missense probably damaging 1.00
X0065:Gal UTSW 19 3411181 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TACGCTGCAGCATAGAAGAACC -3'
(R):5'- ACAGTCCTTCAGATGCTGTC -3'

Sequencing Primer
(F):5'- AACAGTCCCAGATACTTGCTAG -3'
(R):5'- TTCAGATGCTGTCCCCAAATCAGG -3'
Posted On2017-02-28