Incidental Mutation 'R5770:Khdrbs3'
ID462743
Institutional Source Beutler Lab
Gene Symbol Khdrbs3
Ensembl Gene ENSMUSG00000022332
Gene NameKH domain containing, RNA binding, signal transduction associated 3
SynonymsT-STAR, SLM-2, Etle, Salp
MMRRC Submission 043370-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5770 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location68928420-69101211 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 69049463 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022954] [ENSMUST00000022954] [ENSMUST00000229234] [ENSMUST00000229683] [ENSMUST00000230847] [ENSMUST00000230847]
Predicted Effect probably null
Transcript: ENSMUST00000022954
SMART Domains Protein: ENSMUSP00000022954
Gene: ENSMUSG00000022332

DomainStartEndE-ValueType
PDB:2XA6|B 2 27 2e-7 PDB
low complexity region 30 44 N/A INTRINSIC
KH 54 152 8.92e-5 SMART
Pfam:Sam68-YY 266 320 3.6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000022954
SMART Domains Protein: ENSMUSP00000022954
Gene: ENSMUSG00000022332

DomainStartEndE-ValueType
PDB:2XA6|B 2 27 2e-7 PDB
low complexity region 30 44 N/A INTRINSIC
KH 54 152 8.92e-5 SMART
Pfam:Sam68-YY 266 320 3.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229234
Predicted Effect probably benign
Transcript: ENSMUST00000229683
Predicted Effect probably null
Transcript: ENSMUST00000230847
Predicted Effect probably null
Transcript: ENSMUST00000230847
Meta Mutation Damage Score 0.9481 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 93% (64/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with no detectable spatial memory deficits. Males sire slightly smaller litters than control males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik T C 12: 20,815,459 noncoding transcript Het
Abhd8 A G 8: 71,457,328 V392A probably benign Het
AI481877 T C 4: 59,092,466 I238M probably benign Het
Alpk3 A G 7: 81,078,562 E480G probably benign Het
Ankfy1 C G 11: 72,760,256 H1011D probably damaging Het
Aoc3 T G 11: 101,331,752 Y271* probably null Het
Bcl9 T C 3: 97,215,175 I103V probably benign Het
Cgnl1 C T 9: 71,645,487 probably null Het
Cyp2c23 T A 19: 44,021,579 D109V probably damaging Het
Cyp2j13 A T 4: 96,077,432 W13R probably benign Het
D630003M21Rik T C 2: 158,195,580 probably benign Het
Desi2 A T 1: 178,256,495 probably benign Het
Dll3 T C 7: 28,299,009 E177G possibly damaging Het
Ern2 C T 7: 122,179,907 G238D possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm6133 A G 18: 78,350,249 K153E probably benign Het
Gpr68 A T 12: 100,878,821 Y155N probably benign Het
Hcrtr2 T A 9: 76,259,666 I130F probably damaging Het
Hk1 T C 10: 62,286,449 K489R probably benign Het
Ints13 T C 6: 146,555,073 N425S probably damaging Het
Itpkc T C 7: 27,212,988 D578G probably damaging Het
Kcns3 A G 12: 11,092,249 S150P probably benign Het
Kif11 A G 19: 37,390,865 I335V probably benign Het
Lrrn4 C G 2: 132,872,156 C290S probably damaging Het
Macrod2 T C 2: 141,232,182 probably benign Het
Mgam A G 6: 40,669,804 N688S probably benign Het
Myh8 G A 11: 67,297,200 E933K probably damaging Het
Nat8f5 T C 6: 85,817,675 Y101C probably damaging Het
Nhlrc1 A G 13: 47,014,712 V23A probably benign Het
Nkx2-3 T A 19: 43,614,533 F193I probably damaging Het
Nlrp4b T A 7: 10,715,487 V172E probably benign Het
Nmrk1 G T 19: 18,645,074 R172S probably benign Het
Nudcd3 T C 11: 6,113,286 D201G probably damaging Het
Olfr1255 T A 2: 89,816,549 D68E probably damaging Het
Olfr1384 A G 11: 49,514,592 E318G unknown Het
Olfr205 A T 16: 59,329,151 Y119* probably null Het
Olfr314 G A 11: 58,786,594 R120H probably benign Het
Olfr46 A G 7: 140,610,943 Y259C probably damaging Het
Olfr679 A T 7: 105,090,895 I248N probably damaging Het
Olfr980 C T 9: 40,006,338 V204I probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Pcdh15 T A 10: 74,185,345 Y130* probably null Het
Pcdh9 G A 14: 93,886,943 T597I probably damaging Het
Pcdhb19 A G 18: 37,498,037 N295S possibly damaging Het
Pcnx3 T C 19: 5,681,579 probably benign Het
Pdzph1 A T 17: 58,879,151 I1215N probably damaging Het
Phf21a C T 2: 92,351,854 T405I possibly damaging Het
Pkd1l2 C A 8: 117,055,018 G763W probably damaging Het
Prox2 A G 12: 85,087,380 F591L probably benign Het
Robo3 T A 9: 37,419,201 H1033L possibly damaging Het
Sdha A T 13: 74,323,120 C222* probably null Het
Sec16a T C 2: 26,414,390 D2303G probably damaging Het
Slc16a5 A G 11: 115,472,778 K422E possibly damaging Het
Slc22a30 A T 19: 8,386,527 M232K probably damaging Het
Slc35b3 A T 13: 38,937,758 F300I probably damaging Het
Spata2l A G 8: 123,235,720 V34A probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tecta T A 9: 42,345,589 Q1597L possibly damaging Het
Tgfb1i1 A T 7: 128,248,547 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tpm3-rs7 A G 14: 113,315,375 T234A probably benign Het
Usp20 A G 2: 31,017,508 Y684C probably damaging Het
Zc3h4 T A 7: 16,429,611 M585K unknown Het
Zfp292 A G 4: 34,806,747 I2099T probably damaging Het
Other mutations in Khdrbs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02333:Khdrbs3 APN 15 69049394 missense probably damaging 1.00
IGL02756:Khdrbs3 APN 15 69024836 missense probably benign 0.28
IGL03303:Khdrbs3 APN 15 69024823 missense probably benign 0.00
R0014:Khdrbs3 UTSW 15 69024835 missense probably benign 0.00
R0066:Khdrbs3 UTSW 15 68995037 splice site probably benign
R0487:Khdrbs3 UTSW 15 69017361 missense probably damaging 1.00
R1500:Khdrbs3 UTSW 15 68928786 missense possibly damaging 0.90
R1871:Khdrbs3 UTSW 15 69049442 missense probably damaging 1.00
R2002:Khdrbs3 UTSW 15 69013479 intron probably benign
R2111:Khdrbs3 UTSW 15 69024824 missense probably benign 0.25
R2191:Khdrbs3 UTSW 15 69092960 missense probably damaging 0.96
R2290:Khdrbs3 UTSW 15 69029761 missense probably damaging 1.00
R2516:Khdrbs3 UTSW 15 69024695 splice site probably benign
R2940:Khdrbs3 UTSW 15 69049390 missense probably damaging 1.00
R3418:Khdrbs3 UTSW 15 69049375 splice site probably benign
R5885:Khdrbs3 UTSW 15 69024698 critical splice acceptor site probably null
R6829:Khdrbs3 UTSW 15 69092961 missense possibly damaging 0.58
R7288:Khdrbs3 UTSW 15 69049413 missense possibly damaging 0.95
Z1176:Khdrbs3 UTSW 15 69017467 missense probably damaging 1.00
Z1177:Khdrbs3 UTSW 15 68928831 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGACAATCTGGGAGCTTCTTGC -3'
(R):5'- AGCATCCACGTGCGATGATG -3'

Sequencing Primer
(F):5'- AGTTTGACTGAAGCCATACCTC -3'
(R):5'- CATCCACGTGCGATGATGTATGC -3'
Posted On2017-03-01