Mutagenetix > Incidental Mutations

Incidental Mutation 'R5770:Mgam'

446483

Institutional Source

Beutler Lab

Gene Symbol

Mgam

Ensembl Gene

ENSMUSG00000068587

Gene Name

maltase-glucoamylase

Synonyms

6030407P20Rik

MMRRC Submission

043370-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.140) question?

Stock #

R5770 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40628831-40769123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40669804 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 688 (N688S)

Ref Sequence

ENSEMBL: ENSMUSP00000143946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202966]

Predicted Effect

probably benign
Transcript: ENSMUST00000071535
AA Change: N688S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: N688S

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201148
AA Change: N688S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: N688S

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202966

SMART Domains

Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587

Domain	Start	End	E-Value	Type
internal_repeat_1	2	88	2.6e-19	PROSPERO
PD	178	231	1.4e-14	SMART
Pfam:NtCtMGAM_N	242	355	1.1e-26	PFAM
Blast:ANK	395	425	6e-8	BLAST
Pfam:Glyco_hydro_31	443	945	1.3e-137	PFAM

Meta Mutation Damage Score

0.1093

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

93% (64/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030C10Rik	T	C	12: 20,815,459		noncoding transcript	Het
Abhd8	A	G	8: 71,457,328	V392A	probably benign	Het
AI481877	T	C	4: 59,092,466	I238M	probably benign	Het
Alpk3	A	G	7: 81,078,562	E480G	probably benign	Het
Ankfy1	C	G	11: 72,760,256	H1011D	probably damaging	Het
Aoc3	T	G	11: 101,331,752	Y271*	probably null	Het
Bcl9	T	C	3: 97,215,175	I103V	probably benign	Het
Cgnl1	C	T	9: 71,645,487		probably null	Het
Cyp2c23	T	A	19: 44,021,579	D109V	probably damaging	Het
Cyp2j13	A	T	4: 96,077,432	W13R	probably benign	Het
D630003M21Rik	T	C	2: 158,195,580		probably benign	Het
Desi2	A	T	1: 178,256,495		probably benign	Het
Dll3	T	C	7: 28,299,009	E177G	possibly damaging	Het
Ern2	C	T	7: 122,179,907	G238D	possibly damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm6133	A	G	18: 78,350,249	K153E	probably benign	Het
Gpr68	A	T	12: 100,878,821	Y155N	probably benign	Het
Hcrtr2	T	A	9: 76,259,666	I130F	probably damaging	Het
Hk1	T	C	10: 62,286,449	K489R	probably benign	Het
Ints13	T	C	6: 146,555,073	N425S	probably damaging	Het
Itpkc	T	C	7: 27,212,988	D578G	probably damaging	Het
Kcns3	A	G	12: 11,092,249	S150P	probably benign	Het
Khdrbs3	T	A	15: 69,049,463		probably null	Het
Kif11	A	G	19: 37,390,865	I335V	probably benign	Het
Lrrn4	C	G	2: 132,872,156	C290S	probably damaging	Het
Macrod2	T	C	2: 141,232,182		probably benign	Het
Myh8	G	A	11: 67,297,200	E933K	probably damaging	Het
Nat8f5	T	C	6: 85,817,675	Y101C	probably damaging	Het
Nhlrc1	A	G	13: 47,014,712	V23A	probably benign	Het
Nkx2-3	T	A	19: 43,614,533	F193I	probably damaging	Het
Nlrp4b	T	A	7: 10,715,487	V172E	probably benign	Het
Nmrk1	G	T	19: 18,645,074	R172S	probably benign	Het
Nudcd3	T	C	11: 6,113,286	D201G	probably damaging	Het
Olfr1255	T	A	2: 89,816,549	D68E	probably damaging	Het
Olfr1384	A	G	11: 49,514,592	E318G	unknown	Het
Olfr205	A	T	16: 59,329,151	Y119*	probably null	Het
Olfr314	G	A	11: 58,786,594	R120H	probably benign	Het
Olfr46	A	G	7: 140,610,943	Y259C	probably damaging	Het
Olfr679	A	T	7: 105,090,895	I248N	probably damaging	Het
Olfr980	C	T	9: 40,006,338	V204I	probably benign	Het
Oprm1	G	A	10: 6,789,026	G51D	probably damaging	Het
Pcdh15	T	A	10: 74,185,345	Y130*	probably null	Het
Pcdh9	G	A	14: 93,886,943	T597I	probably damaging	Het
Pcdhb19	A	G	18: 37,498,037	N295S	possibly damaging	Het
Pcnx3	T	C	19: 5,681,579		probably benign	Het
Pdzph1	A	T	17: 58,879,151	I1215N	probably damaging	Het
Phf21a	C	T	2: 92,351,854	T405I	possibly damaging	Het
Pkd1l2	C	A	8: 117,055,018	G763W	probably damaging	Het
Prox2	A	G	12: 85,087,380	F591L	probably benign	Het
Robo3	T	A	9: 37,419,201	H1033L	possibly damaging	Het
Sdha	A	T	13: 74,323,120	C222*	probably null	Het
Sec16a	T	C	2: 26,414,390	D2303G	probably damaging	Het
Slc16a5	A	G	11: 115,472,778	K422E	possibly damaging	Het
Slc22a30	A	T	19: 8,386,527	M232K	probably damaging	Het
Slc35b3	A	T	13: 38,937,758	F300I	probably damaging	Het
Spata2l	A	G	8: 123,235,720	V34A	probably damaging	Het
Susd2	C	T	10: 75,638,019	A581T	probably damaging	Het
Tecta	T	A	9: 42,345,589	Q1597L	possibly damaging	Het
Tgfb1i1	A	T	7: 128,248,547		probably benign	Het
Ticam1	TCACACA	TCACA	17: 56,270,629		probably null	Het
Tpm3-rs7	A	G	14: 113,315,375	T234A	probably benign	Het
Usp20	A	G	2: 31,017,508	Y684C	probably damaging	Het
Zc3h4	T	A	7: 16,429,611	M585K	unknown	Het
Zfp292	A	G	4: 34,806,747	I2099T	probably damaging	Het

Other mutations in Mgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Mgam	APN	6	40643010	missense	probably benign
IGL01065:Mgam	APN	6	40662710	critical splice donor site	probably null
IGL01402:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01404:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01413:Mgam	APN	6	40661277	missense	probably damaging	1.00
IGL01546:Mgam	APN	6	40654693	missense	probably damaging	0.98
IGL01596:Mgam	APN	6	40658270	missense	probably damaging	1.00
IGL02133:Mgam	APN	6	40643076	missense	probably damaging	0.98
IGL02734:Mgam	APN	6	40662694	missense	probably damaging	1.00
R0012:Mgam	UTSW	6	40765256	splice site	probably null
R0116:Mgam	UTSW	6	40658987	missense	probably damaging	1.00
R0310:Mgam	UTSW	6	40761035	splice site	probably benign
R0452:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
R0497:Mgam	UTSW	6	40664892	missense	probably damaging	1.00
R0699:Mgam	UTSW	6	40643019	missense	possibly damaging	0.84
R0738:Mgam	UTSW	6	40754935	missense	probably benign	0.01
R1033:Mgam	UTSW	6	40680624	missense	probably benign	0.07
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1430:Mgam	UTSW	6	40756371	missense	probably benign	0.08
R1432:Mgam	UTSW	6	40756367	missense	probably damaging	1.00
R1443:Mgam	UTSW	6	40759780	nonsense	probably null
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1519:Mgam	UTSW	6	40661683	missense	probably benign	0.45
R1654:Mgam	UTSW	6	40757487	missense	probably damaging	1.00
R1667:Mgam	UTSW	6	40677044	missense	possibly damaging	0.62
R1730:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1781:Mgam	UTSW	6	40669863	missense	probably damaging	1.00
R1783:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1829:Mgam	UTSW	6	40666892	missense	probably damaging	1.00
R1833:Mgam	UTSW	6	40654718	critical splice donor site	probably null
R1872:Mgam	UTSW	6	40661300	nonsense	probably null
R1912:Mgam	UTSW	6	40764185	nonsense	probably null
R1977:Mgam	UTSW	6	40664880	missense	probably benign	0.01
R2048:Mgam	UTSW	6	40656429	missense	possibly damaging	0.80
R2086:Mgam	UTSW	6	40761028	splice site	probably null
R2138:Mgam	UTSW	6	40756450	missense	probably damaging	1.00
R2224:Mgam	UTSW	6	40764274	unclassified	probably null
R2408:Mgam	UTSW	6	40686522	missense	probably damaging	1.00
R2508:Mgam	UTSW	6	40759783	missense	probably damaging	1.00
R2842:Mgam	UTSW	6	40661345	missense	probably benign	0.01
R2847:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2848:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2965:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R2966:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R3035:Mgam	UTSW	6	40663530	missense	probably benign
R3895:Mgam	UTSW	6	40759120	missense	probably damaging	1.00
R4027:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4030:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4302:Mgam	UTSW	6	40763085	missense	probably benign	0.02
R4707:Mgam	UTSW	6	40714632	intron	probably null
R4826:Mgam	UTSW	6	40680648	missense	possibly damaging	0.52
R4898:Mgam	UTSW	6	40643054	missense	probably benign
R5438:Mgam	UTSW	6	40684521	missense	probably damaging	1.00
R5492:Mgam	UTSW	6	40756363	missense	probably damaging	1.00
R5839:Mgam	UTSW	6	40740064	missense	possibly damaging	0.90
R5845:Mgam	UTSW	6	40675323	missense	possibly damaging	0.78
R5847:Mgam	UTSW	6	40684055	missense	probably benign	0.42
R5891:Mgam	UTSW	6	40744348	missense	probably benign
R6158:Mgam	UTSW	6	40757714	missense	probably damaging	1.00
R6193:Mgam	UTSW	6	40747920	nonsense	probably null
R6423:Mgam	UTSW	6	40677045	missense	possibly damaging	0.84
R6706:Mgam	UTSW	6	40744786	missense	probably benign	0.00
R6813:Mgam	UTSW	6	40750165	missense	probably damaging	0.99
R6863:Mgam	UTSW	6	40729009	missense	probably benign	0.00
R6906:Mgam	UTSW	6	40747919	missense	probably damaging	1.00
R7091:Mgam	UTSW	6	40768276	missense	possibly damaging	0.95
R7099:Mgam	UTSW	6	40661716	missense	probably benign	0.09
R7282:Mgam	UTSW	6	40656512	missense	possibly damaging	0.71
R7282:Mgam	UTSW	6	40763111	missense	probably benign
R7354:Mgam	UTSW	6	40744798	missense	probably damaging	1.00
R7374:Mgam	UTSW	6	40757439	missense	possibly damaging	0.89
R7399:Mgam	UTSW	6	40666854	missense	probably damaging	0.99
R7406:Mgam	UTSW	6	40663525	missense	probably benign	0.13
R7446:Mgam	UTSW	6	40746332	missense	probably damaging	1.00
R7466:Mgam	UTSW	6	40744789	missense	probably benign	0.00
R7525:Mgam	UTSW	6	40766020	missense	probably benign	0.01
R7530:Mgam	UTSW	6	40709218	intron	probably null
R7570:Mgam	UTSW	6	40746433	missense	probably benign	0.16
R7669:Mgam	UTSW	6	40659010	missense	probably benign	0.00
R7679:Mgam	UTSW	6	40643046	missense	probably damaging	0.98
R7746:Mgam	UTSW	6	40668193	missense	probably damaging	0.99
R7859:Mgam	UTSW	6	40740179	missense	possibly damaging	0.75
R7942:Mgam	UTSW	6	40740179	missense	possibly damaging	0.75
RF011:Mgam	UTSW	6	40757436	missense	probably damaging	1.00
RF020:Mgam	UTSW	6	40685309	missense	probably damaging	1.00
RF023:Mgam	UTSW	6	40680708	missense	probably benign
X0021:Mgam	UTSW	6	40659047	missense	probably damaging	1.00
Z1088:Mgam	UTSW	6	40643060	missense	probably benign	0.01
Z1176:Mgam	UTSW	6	40677644	critical splice donor site	probably null
Z1176:Mgam	UTSW	6	40729066	missense	probably damaging	1.00
Z1177:Mgam	UTSW	6	40740071	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTCTCCAGCTGTGTCATG -3'
(R):5'- TCCTGAATACCTTGCTTGGG -3'

Sequencing Primer
(F):5'- TCTCCAGCTGTGTCATGCAGAG -3'
(R):5'- TGCTTGGGTGGTTTTATATTTTACTC -3'

Posted On

2016-11-21