Incidental Mutation 'R5969:Pdlim4'
ID 470753
Institutional Source Beutler Lab
Gene Symbol Pdlim4
Ensembl Gene ENSMUSG00000020388
Gene Name PDZ and LIM domain 4
Synonyms Ril
MMRRC Submission 044152-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock # R5969 (G1)
Quality Score 191
Status Validated
Chromosome 11
Chromosomal Location 54054928-54069014 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 54063656 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 75 (H75R)
Ref Sequence ENSEMBL: ENSMUSP00000090797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018755] [ENSMUST00000093109] [ENSMUST00000144477]
AlphaFold P70271
Predicted Effect probably benign
Transcript: ENSMUST00000018755
AA Change: H75R

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000018755
Gene: ENSMUSG00000020388
AA Change: H75R

DomainStartEndE-ValueType
PDZ 11 84 1.05e-17 SMART
Pfam:DUF4749 142 230 7.2e-14 PFAM
LIM 254 305 9.75e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000093109
AA Change: H75R

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090797
Gene: ENSMUSG00000020388
AA Change: H75R

DomainStartEndE-ValueType
PDZ 11 84 1.05e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127271
Predicted Effect probably benign
Transcript: ENSMUST00000144477
AA Change: H16R

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121248
Gene: ENSMUSG00000020388
AA Change: H16R

DomainStartEndE-ValueType
Blast:PDZ 1 25 2e-10 BLAST
SCOP:d1qava_ 1 25 3e-4 SMART
PDB:2V1W|B 1 28 2e-11 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151948
Meta Mutation Damage Score 0.0856 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which may be involved in bone development. Mutations in this gene are associated with susceptibility to osteoporosis. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,350,564 Y19D probably damaging Het
Abca13 T A 11: 9,292,214 L1359* probably null Het
Ahi1 A T 10: 20,984,393 D671V probably damaging Het
Ahnak T C 19: 9,016,585 S5078P probably damaging Het
Ankhd1 A T 18: 36,600,834 T584S probably damaging Het
Apba2 T A 7: 64,744,447 L568* probably null Het
Cenpn C A 8: 116,940,537 L300I probably damaging Het
Cmya5 A T 13: 93,089,544 L3012Q possibly damaging Het
Cnnm1 T C 19: 43,491,472 S819P probably damaging Het
Cpa6 A T 1: 10,488,883 S87T probably benign Het
Crybg2 T A 4: 134,075,692 probably null Het
Csmd1 T A 8: 16,071,353 T1777S probably benign Het
Csmd3 G T 15: 47,947,990 P1235Q probably damaging Het
Cxcr4 T A 1: 128,589,847 N24Y probably benign Het
D630003M21Rik G T 2: 158,217,708 H91N probably damaging Het
Ece1 T C 4: 137,961,740 probably null Het
Edc3 T C 9: 57,713,428 S11P probably damaging Het
Exoc3 G A 13: 74,172,186 Q719* probably null Het
Fam13a A G 6: 58,965,198 M203T probably damaging Het
Fam160b1 C T 19: 57,384,123 R602* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fxyd2 T A 9: 45,408,330 I30N probably damaging Het
Gapt A G 13: 110,353,946 V61A probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gm2035 T C 12: 87,919,478 D127G unknown Het
Gpr35 T C 1: 92,983,220 V2A probably damaging Het
Gtf3c1 A G 7: 125,645,676 S1729P possibly damaging Het
Heatr5a T C 12: 51,959,040 T51A probably benign Het
Kat6b G A 14: 21,670,792 M1737I probably damaging Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klk10 A G 7: 43,784,985 Y267C probably damaging Het
Lgmn T C 12: 102,405,827 Y98C probably damaging Het
Lyst A C 13: 13,687,813 probably null Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mfng A T 15: 78,764,382 V165D possibly damaging Het
Mto1 A G 9: 78,452,905 E225G probably damaging Het
Notch3 C A 17: 32,153,884 C571F probably damaging Het
Nup205 C T 6: 35,177,578 probably benign Het
Olfr65 T A 7: 103,906,910 I157N probably damaging Het
P2ry14 T A 3: 59,115,158 I303F probably damaging Het
Pcnx3 T C 19: 5,685,535 D421G probably damaging Het
Phf21a A T 2: 92,221,611 H17L probably damaging Het
Ppid T A 3: 79,597,717 N122K probably damaging Het
Ppp4r3a T C 12: 101,043,579 I613V probably benign Het
Prcp C T 7: 92,917,766 P229S probably benign Het
Ralgds T C 2: 28,542,414 V85A probably damaging Het
Rgs22 G A 15: 36,015,636 T1034I probably benign Het
Slc4a3 T C 1: 75,549,979 V48A probably damaging Het
Snx16 A T 3: 10,438,157 M10K possibly damaging Het
Svep1 G A 4: 58,070,977 Q2270* probably null Het
Tmem185b T G 1: 119,527,463 I318S probably benign Het
Tnik C T 3: 28,620,948 R657C probably damaging Het
Top3b T C 16: 16,883,565 probably null Het
Trim40 C T 17: 36,882,427 R203H probably benign Het
Triobp T A 15: 78,967,540 N631K probably benign Het
Ubr3 T G 2: 69,979,386 Y1233* probably null Het
Vgll3 A G 16: 65,839,563 D200G probably damaging Het
Vmn2r24 G A 6: 123,779,022 E18K probably benign Het
Zfp141 C A 7: 42,489,488 R40L probably damaging Het
Other mutations in Pdlim4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Pdlim4 APN 11 54056304 missense probably benign 0.43
IGL02005:Pdlim4 APN 11 54059984 missense probably benign 0.10
IGL02305:Pdlim4 APN 11 54055933 missense probably damaging 1.00
IGL03073:Pdlim4 APN 11 54063641 missense probably damaging 1.00
BB001:Pdlim4 UTSW 11 54055222 nonsense probably null
BB011:Pdlim4 UTSW 11 54055222 nonsense probably null
R0008:Pdlim4 UTSW 11 54055049 missense probably damaging 1.00
R0612:Pdlim4 UTSW 11 54068887 missense probably damaging 1.00
R1646:Pdlim4 UTSW 11 54056254 missense possibly damaging 0.94
R1754:Pdlim4 UTSW 11 54055873 missense possibly damaging 0.82
R2132:Pdlim4 UTSW 11 54063737 missense possibly damaging 0.70
R3037:Pdlim4 UTSW 11 54056257 missense probably benign 0.15
R4210:Pdlim4 UTSW 11 54055918 missense possibly damaging 0.70
R5787:Pdlim4 UTSW 11 54055216 missense probably damaging 1.00
R6862:Pdlim4 UTSW 11 54055848 missense probably damaging 1.00
R7924:Pdlim4 UTSW 11 54055222 nonsense probably null
R8927:Pdlim4 UTSW 11 54059964 missense probably benign 0.01
R8928:Pdlim4 UTSW 11 54059964 missense probably benign 0.01
R9026:Pdlim4 UTSW 11 54055454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAACCCTGGATTGTAAAGGC -3'
(R):5'- TTGATGGGAATCTAGTGCAGGC -3'

Sequencing Primer
(F):5'- TGGATTGTAAAGGCTCCTCCCAG -3'
(R):5'- TGCAGGCGTCCATGTAGTAAC -3'
Posted On 2017-03-31