Incidental Mutation 'R5946:Gpatch1'
ID472170
Institutional Source Beutler Lab
Gene Symbol Gpatch1
Ensembl Gene ENSMUSG00000063808
Gene NameG patch domain containing 1
SynonymsGpatc1, 1300003A17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5946 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location35276536-35318440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35291832 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 596 (S596P)
Ref Sequence ENSEMBL: ENSMUSP00000117475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079693] [ENSMUST00000131143] [ENSMUST00000131213]
Predicted Effect probably damaging
Transcript: ENSMUST00000079693
AA Change: S596P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078632
Gene: ENSMUSG00000063808
AA Change: S596P

DomainStartEndE-ValueType
Pfam:DUF1604 31 116 2.1e-39 PFAM
G_patch 150 191 4.72e-1 SMART
low complexity region 200 209 N/A INTRINSIC
low complexity region 456 478 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 759 780 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 847 897 N/A INTRINSIC
low complexity region 899 909 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131143
SMART Domains Protein: ENSMUSP00000121711
Gene: ENSMUSG00000063808

DomainStartEndE-ValueType
Pfam:DUF1604 29 98 2.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131213
AA Change: S596P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117475
Gene: ENSMUSG00000063808
AA Change: S596P

DomainStartEndE-ValueType
Pfam:DUF1604 31 116 7.9e-40 PFAM
G_patch 150 191 4.72e-1 SMART
low complexity region 200 209 N/A INTRINSIC
low complexity region 456 478 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 759 780 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 849 881 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,625,952 F1137S probably damaging Het
Actr6 G T 10: 89,728,192 Q73K probably benign Het
Adamtsl3 G A 7: 82,576,057 G358D probably damaging Het
Aggf1 A G 13: 95,371,576 V94A probably damaging Het
Arpc3 A G 5: 122,403,396 Y57C probably damaging Het
Asb2 A G 12: 103,321,555 Y630H probably benign Het
Atp1a1 A T 3: 101,589,774 N405K probably benign Het
C6 G T 15: 4,808,514 D869Y possibly damaging Het
Cds2 A G 2: 132,297,248 Y137C probably damaging Het
Ceacam12 A T 7: 18,069,206 E179V probably damaging Het
Chgb T A 2: 132,792,596 Y153N probably benign Het
Cit T A 5: 115,997,534 L1831Q probably damaging Het
Cpne8 C A 15: 90,488,988 *578L probably null Het
Cspg5 A G 9: 110,251,083 T440A probably damaging Het
Dnah7a A C 1: 53,559,308 V1393G probably damaging Het
Dnajb8 A G 6: 88,222,593 D37G probably benign Het
Dst A G 1: 34,174,192 I1063M probably benign Het
Efs T G 14: 54,919,494 probably null Het
Hbs1l C A 10: 21,341,756 H190Q probably benign Het
Ighm A G 12: 113,422,709 V7A unknown Het
Ivd A T 2: 118,876,889 I295F possibly damaging Het
Kcnq5 A C 1: 21,505,707 S258A probably damaging Het
Mad1l1 G T 5: 140,261,579 P331Q probably damaging Het
Mcf2l G T 8: 13,013,922 G1045C probably damaging Het
Mcoln1 T A 8: 3,508,701 I233N probably damaging Het
Mmp13 T C 9: 7,276,580 L225P probably damaging Het
Muc5ac G A 7: 141,817,907 C2615Y possibly damaging Het
Myh7b T C 2: 155,621,395 F516L probably damaging Het
Obsl1 A T 1: 75,491,207 S1347R probably damaging Het
Ogn A G 13: 49,618,285 N207S probably benign Het
Olfr132 C A 17: 38,130,707 A162S probably benign Het
Olfr874 T A 9: 37,747,034 L300Q probably damaging Het
Pcdha2 G T 18: 36,941,106 V597L probably damaging Het
Pcnt T A 10: 76,382,063 Y2126F possibly damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Pklr A T 3: 89,136,196 E5V probably benign Het
Pkp4 T A 2: 59,305,067 D94E probably benign Het
Ppan C T 9: 20,889,673 Q111* probably null Het
Prkcb A G 7: 122,544,703 N330S probably benign Het
Prl4a1 T A 13: 28,018,516 W25R probably damaging Het
Rars2 T A 4: 34,656,855 H501Q possibly damaging Het
Ryr2 T C 13: 11,726,953 D2114G probably damaging Het
Serinc2 G T 4: 130,255,521 T351K possibly damaging Het
Slc22a12 A G 19: 6,537,851 F358L probably damaging Het
Sorcs2 A C 5: 36,029,083 V905G probably damaging Het
Tekt3 G C 11: 63,094,747 A460P probably damaging Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Tmc5 A T 7: 118,670,725 E899D probably damaging Het
Tmem268 C T 4: 63,568,509 P90S probably damaging Het
Trim38 A G 13: 23,782,734 M55V probably benign Het
Trip10 T G 17: 57,250,963 V50G probably damaging Het
Usp25 T A 16: 77,115,054 C990* probably null Het
Uts2 A G 4: 150,999,049 D39G probably benign Het
Vezf1 T A 11: 88,073,734 C49* probably null Het
Wee2 T A 6: 40,463,212 N431K probably null Het
Yeats2 C A 16: 20,207,763 Y796* probably null Het
Zfp592 G A 7: 81,037,897 G890D possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Gpatch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Gpatch1 APN 7 35276813 critical splice acceptor site probably null
IGL01143:Gpatch1 APN 7 35301572 splice site probably benign
IGL01523:Gpatch1 APN 7 35308338 missense probably null 1.00
IGL01862:Gpatch1 APN 7 35295278 missense probably benign
IGL02349:Gpatch1 APN 7 35307255 missense probably damaging 1.00
IGL02792:Gpatch1 APN 7 35301593 missense probably damaging 0.96
IGL02926:Gpatch1 APN 7 35308269 missense probably damaging 1.00
IGL03099:Gpatch1 APN 7 35297523 missense possibly damaging 0.87
IGL03107:Gpatch1 APN 7 35303317 missense probably benign 0.35
IGL03324:Gpatch1 APN 7 35299280 missense probably damaging 0.96
IGL03324:Gpatch1 APN 7 35293695 missense possibly damaging 0.81
R0066:Gpatch1 UTSW 7 35287227 missense probably damaging 1.00
R0066:Gpatch1 UTSW 7 35287227 missense probably damaging 1.00
R0137:Gpatch1 UTSW 7 35287242 missense probably damaging 1.00
R0347:Gpatch1 UTSW 7 35297631 missense probably benign 0.16
R0382:Gpatch1 UTSW 7 35301655 missense probably damaging 1.00
R0390:Gpatch1 UTSW 7 35281381 intron probably benign
R0791:Gpatch1 UTSW 7 35281376 intron probably benign
R1162:Gpatch1 UTSW 7 35303480 splice site probably benign
R1374:Gpatch1 UTSW 7 35291762 missense probably damaging 1.00
R1480:Gpatch1 UTSW 7 35303338 missense probably damaging 1.00
R1556:Gpatch1 UTSW 7 35295351 missense probably benign 0.00
R1682:Gpatch1 UTSW 7 35303387 missense possibly damaging 0.80
R1887:Gpatch1 UTSW 7 35303388 missense probably damaging 0.98
R1935:Gpatch1 UTSW 7 35295522 missense probably damaging 1.00
R1936:Gpatch1 UTSW 7 35295522 missense probably damaging 1.00
R2148:Gpatch1 UTSW 7 35299276 missense probably benign 0.16
R2205:Gpatch1 UTSW 7 35291772 missense probably damaging 1.00
R2215:Gpatch1 UTSW 7 35293827 missense possibly damaging 0.48
R2274:Gpatch1 UTSW 7 35288678 missense probably benign 0.00
R2275:Gpatch1 UTSW 7 35288678 missense probably benign 0.00
R4126:Gpatch1 UTSW 7 35293654 critical splice donor site probably null
R4705:Gpatch1 UTSW 7 35299305 splice site probably null
R5227:Gpatch1 UTSW 7 35309351 missense probably benign 0.09
R5567:Gpatch1 UTSW 7 35307215 missense probably damaging 0.99
R5810:Gpatch1 UTSW 7 35295371 missense probably benign 0.01
R6263:Gpatch1 UTSW 7 35303423 missense probably damaging 1.00
R6386:Gpatch1 UTSW 7 35291840 missense probably damaging 1.00
R6569:Gpatch1 UTSW 7 35291738 missense probably damaging 1.00
R6847:Gpatch1 UTSW 7 35293558 intron probably null
R7186:Gpatch1 UTSW 7 35295313 missense possibly damaging 0.86
R7259:Gpatch1 UTSW 7 35287121 critical splice donor site probably null
R7276:Gpatch1 UTSW 7 35297496 missense probably benign 0.00
R7516:Gpatch1 UTSW 7 35308200 missense probably benign 0.09
R7521:Gpatch1 UTSW 7 35293788 missense probably damaging 1.00
R7561:Gpatch1 UTSW 7 35309375 missense probably damaging 1.00
R7570:Gpatch1 UTSW 7 35293812 missense probably damaging 1.00
R7588:Gpatch1 UTSW 7 35291748 missense probably damaging 1.00
R7843:Gpatch1 UTSW 7 35281454 missense unknown
R7926:Gpatch1 UTSW 7 35281454 missense unknown
X0020:Gpatch1 UTSW 7 35295381 missense probably benign 0.09
Z1176:Gpatch1 UTSW 7 35310485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACAGGAGCATAGTATGAACTC -3'
(R):5'- CCAAACAACTTCATATATGAGTGCC -3'

Sequencing Primer
(F):5'- AGCTCTTCTAAGCCCTAAGGGTAG -3'
(R):5'- ATCCTCTGGAGCTGGAGTGAC -3'
Posted On2017-03-31